ID: 995990639

View in Genome Browser
Species Human (GRCh38)
Location 5:118234651-118234673
Sequence AGTCAGATTATAACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995990635_995990639 1 Left 995990635 5:118234627-118234649 CCTCCTAATGCCCATGCTATGAA No data
Right 995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG No data
995990636_995990639 -2 Left 995990636 5:118234630-118234652 CCTAATGCCCATGCTATGAAGAG No data
Right 995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG No data
995990634_995990639 4 Left 995990634 5:118234624-118234646 CCTCCTCCTAATGCCCATGCTAT No data
Right 995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG No data
995990637_995990639 -9 Left 995990637 5:118234637-118234659 CCCATGCTATGAAGAGTCAGATT No data
Right 995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG No data
995990638_995990639 -10 Left 995990638 5:118234638-118234660 CCATGCTATGAAGAGTCAGATTA No data
Right 995990639 5:118234651-118234673 AGTCAGATTATAACACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995990639 Original CRISPR AGTCAGATTATAACACAAGC AGG Intergenic
No off target data available for this crispr