ID: 996007422

View in Genome Browser
Species Human (GRCh38)
Location 5:118439542-118439564
Sequence CTTTATATGTTGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996007422_996007428 6 Left 996007422 5:118439542-118439564 CCACCCACCCTCAACATATAAAG No data
Right 996007428 5:118439571-118439593 TCTTAATTTCTACTAGAATCTGG No data
996007422_996007429 9 Left 996007422 5:118439542-118439564 CCACCCACCCTCAACATATAAAG No data
Right 996007429 5:118439574-118439596 TAATTTCTACTAGAATCTGGTGG No data
996007422_996007430 10 Left 996007422 5:118439542-118439564 CCACCCACCCTCAACATATAAAG No data
Right 996007430 5:118439575-118439597 AATTTCTACTAGAATCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996007422 Original CRISPR CTTTATATGTTGAGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr