ID: 996013730

View in Genome Browser
Species Human (GRCh38)
Location 5:118508074-118508096
Sequence CAGGACATGCTGAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996013723_996013730 19 Left 996013723 5:118508032-118508054 CCAGGCACTCAGAGACCTGCTGG No data
Right 996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG No data
996013726_996013730 4 Left 996013726 5:118508047-118508069 CCTGCTGGATTGGCAGAGACATG No data
Right 996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG No data
996013722_996013730 20 Left 996013722 5:118508031-118508053 CCCAGGCACTCAGAGACCTGCTG No data
Right 996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996013730 Original CRISPR CAGGACATGCTGAAGTAGGC AGG Intergenic
No off target data available for this crispr