ID: 996015256

View in Genome Browser
Species Human (GRCh38)
Location 5:118526502-118526524
Sequence CCACATCAAAATGGTTTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996015252_996015256 15 Left 996015252 5:118526464-118526486 CCTCATCTAGAACTTCAGAAGTC No data
Right 996015256 5:118526502-118526524 CCACATCAAAATGGTTTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996015256 Original CRISPR CCACATCAAAATGGTTTTAA CGG Intergenic
No off target data available for this crispr