ID: 996017196

View in Genome Browser
Species Human (GRCh38)
Location 5:118552878-118552900
Sequence CCATAGGTTTGCAACTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996017196_996017202 25 Left 996017196 5:118552878-118552900 CCTGTCAAGTTGCAAACCTATGG No data
Right 996017202 5:118552926-118552948 TTCCAAACTGGAATACCTGGTGG No data
996017196_996017203 26 Left 996017196 5:118552878-118552900 CCTGTCAAGTTGCAAACCTATGG No data
Right 996017203 5:118552927-118552949 TCCAAACTGGAATACCTGGTGGG No data
996017196_996017200 13 Left 996017196 5:118552878-118552900 CCTGTCAAGTTGCAAACCTATGG No data
Right 996017200 5:118552914-118552936 AGAGTGACGAAGTTCCAAACTGG No data
996017196_996017201 22 Left 996017196 5:118552878-118552900 CCTGTCAAGTTGCAAACCTATGG No data
Right 996017201 5:118552923-118552945 AAGTTCCAAACTGGAATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996017196 Original CRISPR CCATAGGTTTGCAACTTGAC AGG (reversed) Intergenic
No off target data available for this crispr