ID: 996019247

View in Genome Browser
Species Human (GRCh38)
Location 5:118573683-118573705
Sequence AGGAAAACGGCAGTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996019247_996019256 2 Left 996019247 5:118573683-118573705 CCTTCCCCCACTGCCGTTTTCCT No data
Right 996019256 5:118573708-118573730 TGGCTCCTTTTAATCACTCAGGG No data
996019247_996019255 1 Left 996019247 5:118573683-118573705 CCTTCCCCCACTGCCGTTTTCCT No data
Right 996019255 5:118573707-118573729 CTGGCTCCTTTTAATCACTCAGG No data
996019247_996019258 27 Left 996019247 5:118573683-118573705 CCTTCCCCCACTGCCGTTTTCCT No data
Right 996019258 5:118573733-118573755 AAGCTAAAACTGTCCCTCCTTGG No data
996019247_996019259 28 Left 996019247 5:118573683-118573705 CCTTCCCCCACTGCCGTTTTCCT No data
Right 996019259 5:118573734-118573756 AGCTAAAACTGTCCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996019247 Original CRISPR AGGAAAACGGCAGTGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr