ID: 996021534

View in Genome Browser
Species Human (GRCh38)
Location 5:118595948-118595970
Sequence CTGTGTGAAGACAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996021534_996021537 -10 Left 996021534 5:118595948-118595970 CCATGTTCCCTGTCTTCACACAG No data
Right 996021537 5:118595961-118595983 CTTCACACAGCCTCTCACAGTGG No data
996021534_996021543 28 Left 996021534 5:118595948-118595970 CCATGTTCCCTGTCTTCACACAG No data
Right 996021543 5:118595999-118596021 ACGTTTCCTTCTCCTTTCTCAGG No data
996021534_996021540 0 Left 996021534 5:118595948-118595970 CCATGTTCCCTGTCTTCACACAG No data
Right 996021540 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data
996021534_996021538 -5 Left 996021534 5:118595948-118595970 CCATGTTCCCTGTCTTCACACAG No data
Right 996021538 5:118595966-118595988 CACAGCCTCTCACAGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996021534 Original CRISPR CTGTGTGAAGACAGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr