ID: 996021535

View in Genome Browser
Species Human (GRCh38)
Location 5:118595955-118595977
Sequence TGAGAGGCTGTGTGAAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996021535_996021540 -7 Left 996021535 5:118595955-118595977 CCCTGTCTTCACACAGCCTCTCA No data
Right 996021540 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data
996021535_996021543 21 Left 996021535 5:118595955-118595977 CCCTGTCTTCACACAGCCTCTCA No data
Right 996021543 5:118595999-118596021 ACGTTTCCTTCTCCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996021535 Original CRISPR TGAGAGGCTGTGTGAAGACA GGG (reversed) Intergenic
No off target data available for this crispr