ID: 996021537

View in Genome Browser
Species Human (GRCh38)
Location 5:118595961-118595983
Sequence CTTCACACAGCCTCTCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996021531_996021537 22 Left 996021531 5:118595916-118595938 CCACAAGGCAGAGAGAAAAGAAT No data
Right 996021537 5:118595961-118595983 CTTCACACAGCCTCTCACAGTGG No data
996021534_996021537 -10 Left 996021534 5:118595948-118595970 CCATGTTCCCTGTCTTCACACAG No data
Right 996021537 5:118595961-118595983 CTTCACACAGCCTCTCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996021537 Original CRISPR CTTCACACAGCCTCTCACAG TGG Intergenic
No off target data available for this crispr