ID: 996021539

View in Genome Browser
Species Human (GRCh38)
Location 5:118595971-118595993
Sequence CCAGGCCACACCACTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996021539_996021543 5 Left 996021539 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data
Right 996021543 5:118595999-118596021 ACGTTTCCTTCTCCTTTCTCAGG No data
996021539_996021546 20 Left 996021539 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data
Right 996021546 5:118596014-118596036 TTCTCAGGCTGCCCTATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996021539 Original CRISPR CCAGGCCACACCACTGTGAG AGG (reversed) Intergenic
No off target data available for this crispr