ID: 996021540

View in Genome Browser
Species Human (GRCh38)
Location 5:118595971-118595993
Sequence CCTCTCACAGTGGTGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996021536_996021540 -8 Left 996021536 5:118595956-118595978 CCTGTCTTCACACAGCCTCTCAC No data
Right 996021540 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data
996021535_996021540 -7 Left 996021535 5:118595955-118595977 CCCTGTCTTCACACAGCCTCTCA No data
Right 996021540 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data
996021534_996021540 0 Left 996021534 5:118595948-118595970 CCATGTTCCCTGTCTTCACACAG No data
Right 996021540 5:118595971-118595993 CCTCTCACAGTGGTGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996021540 Original CRISPR CCTCTCACAGTGGTGTGGCC TGG Intergenic
No off target data available for this crispr