ID: 996025461

View in Genome Browser
Species Human (GRCh38)
Location 5:118640292-118640314
Sequence ATGTATTTGCGTGGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996025461_996025464 13 Left 996025461 5:118640292-118640314 CCTTTAAAACCACGCAAATACAT No data
Right 996025464 5:118640328-118640350 CTTGCTCCTGAACGATCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996025461 Original CRISPR ATGTATTTGCGTGGTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr