ID: 996034223

View in Genome Browser
Species Human (GRCh38)
Location 5:118740014-118740036
Sequence CAGGGTCACCACAGCCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996034216_996034223 17 Left 996034216 5:118739974-118739996 CCACACAGAGGCCCTCACATCAC No data
Right 996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG No data
996034218_996034223 5 Left 996034218 5:118739986-118740008 CCTCACATCACTTTTAATTACAG No data
Right 996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG No data
996034217_996034223 6 Left 996034217 5:118739985-118740007 CCCTCACATCACTTTTAATTACA No data
Right 996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996034223 Original CRISPR CAGGGTCACCACAGCCAGAT GGG Intergenic
No off target data available for this crispr