ID: 996035360

View in Genome Browser
Species Human (GRCh38)
Location 5:118752703-118752725
Sequence ACTGCTATGTGAACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996035360_996035362 1 Left 996035360 5:118752703-118752725 CCTTCCACAGTTCACATAGCAGT No data
Right 996035362 5:118752727-118752749 TAATCTATATTTACATCATAAGG No data
996035360_996035363 2 Left 996035360 5:118752703-118752725 CCTTCCACAGTTCACATAGCAGT No data
Right 996035363 5:118752728-118752750 AATCTATATTTACATCATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996035360 Original CRISPR ACTGCTATGTGAACTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr