ID: 996035704

View in Genome Browser
Species Human (GRCh38)
Location 5:118756534-118756556
Sequence GTTCTGTTAGCAAGGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996035704_996035712 15 Left 996035704 5:118756534-118756556 CCCATCCTCCTTGCTAACAGAAC No data
Right 996035712 5:118756572-118756594 CAGCCCTATGCCCAGTCCCATGG No data
996035704_996035713 16 Left 996035704 5:118756534-118756556 CCCATCCTCCTTGCTAACAGAAC No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035704_996035708 -8 Left 996035704 5:118756534-118756556 CCCATCCTCCTTGCTAACAGAAC No data
Right 996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG No data
996035704_996035718 26 Left 996035704 5:118756534-118756556 CCCATCCTCCTTGCTAACAGAAC No data
Right 996035718 5:118756583-118756605 CCAGTCCCATGGGATGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996035704 Original CRISPR GTTCTGTTAGCAAGGAGGAT GGG (reversed) Intergenic