ID: 996035705

View in Genome Browser
Species Human (GRCh38)
Location 5:118756535-118756557
Sequence GGTTCTGTTAGCAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996035705_996035718 25 Left 996035705 5:118756535-118756557 CCATCCTCCTTGCTAACAGAACC No data
Right 996035718 5:118756583-118756605 CCAGTCCCATGGGATGAGTAAGG No data
996035705_996035708 -9 Left 996035705 5:118756535-118756557 CCATCCTCCTTGCTAACAGAACC No data
Right 996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG No data
996035705_996035713 15 Left 996035705 5:118756535-118756557 CCATCCTCCTTGCTAACAGAACC No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035705_996035712 14 Left 996035705 5:118756535-118756557 CCATCCTCCTTGCTAACAGAACC No data
Right 996035712 5:118756572-118756594 CAGCCCTATGCCCAGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996035705 Original CRISPR GGTTCTGTTAGCAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr