ID: 996035706

View in Genome Browser
Species Human (GRCh38)
Location 5:118756539-118756561
Sequence ATGGGGTTCTGTTAGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996035706_996035712 10 Left 996035706 5:118756539-118756561 CCTCCTTGCTAACAGAACCCCAT No data
Right 996035712 5:118756572-118756594 CAGCCCTATGCCCAGTCCCATGG No data
996035706_996035718 21 Left 996035706 5:118756539-118756561 CCTCCTTGCTAACAGAACCCCAT No data
Right 996035718 5:118756583-118756605 CCAGTCCCATGGGATGAGTAAGG No data
996035706_996035713 11 Left 996035706 5:118756539-118756561 CCTCCTTGCTAACAGAACCCCAT No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996035706 Original CRISPR ATGGGGTTCTGTTAGCAAGG AGG (reversed) Intergenic