ID: 996035708

View in Genome Browser
Species Human (GRCh38)
Location 5:118756549-118756571
Sequence AACAGAACCCCATGTAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996035704_996035708 -8 Left 996035704 5:118756534-118756556 CCCATCCTCCTTGCTAACAGAAC No data
Right 996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG No data
996035705_996035708 -9 Left 996035705 5:118756535-118756557 CCATCCTCCTTGCTAACAGAACC No data
Right 996035708 5:118756549-118756571 AACAGAACCCCATGTAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996035708 Original CRISPR AACAGAACCCCATGTAGTTC AGG Intergenic
No off target data available for this crispr