ID: 996035713

View in Genome Browser
Species Human (GRCh38)
Location 5:118756573-118756595
Sequence AGCCCTATGCCCAGTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996035704_996035713 16 Left 996035704 5:118756534-118756556 CCCATCCTCCTTGCTAACAGAAC No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035709_996035713 -6 Left 996035709 5:118756556-118756578 CCCCATGTAGTTCAGGCAGCCCT No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035705_996035713 15 Left 996035705 5:118756535-118756557 CCATCCTCCTTGCTAACAGAACC No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035711_996035713 -8 Left 996035711 5:118756558-118756580 CCATGTAGTTCAGGCAGCCCTAT No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035710_996035713 -7 Left 996035710 5:118756557-118756579 CCCATGTAGTTCAGGCAGCCCTA No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035706_996035713 11 Left 996035706 5:118756539-118756561 CCTCCTTGCTAACAGAACCCCAT No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data
996035707_996035713 8 Left 996035707 5:118756542-118756564 CCTTGCTAACAGAACCCCATGTA No data
Right 996035713 5:118756573-118756595 AGCCCTATGCCCAGTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996035713 Original CRISPR AGCCCTATGCCCAGTCCCAT GGG Intergenic