ID: 996037165

View in Genome Browser
Species Human (GRCh38)
Location 5:118771342-118771364
Sequence TGGAAAAATCACAATGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996037159_996037165 21 Left 996037159 5:118771298-118771320 CCAGCCACACATATCCTATTTGA No data
Right 996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG No data
996037160_996037165 17 Left 996037160 5:118771302-118771324 CCACACATATCCTATTTGAAGAA No data
Right 996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG No data
996037161_996037165 7 Left 996037161 5:118771312-118771334 CCTATTTGAAGAATTCCATTAAA No data
Right 996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG No data
996037163_996037165 -8 Left 996037163 5:118771327-118771349 CCATTAAATGTCTTTTGGAAAAA No data
Right 996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996037165 Original CRISPR TGGAAAAATCACAATGTGGT TGG Intergenic
No off target data available for this crispr