ID: 996037596

View in Genome Browser
Species Human (GRCh38)
Location 5:118775836-118775858
Sequence TGATAGCTAGTTATTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996037595_996037596 21 Left 996037595 5:118775792-118775814 CCTCTTCTTTTGGATAAAGCATT No data
Right 996037596 5:118775836-118775858 TGATAGCTAGTTATTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996037596 Original CRISPR TGATAGCTAGTTATTGAAAC TGG Intergenic