ID: 996039161

View in Genome Browser
Species Human (GRCh38)
Location 5:118791277-118791299
Sequence AAAACTTTCTTCACAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996039161_996039164 20 Left 996039161 5:118791277-118791299 CCTATTTTTGTGAAGAAAGTTTT No data
Right 996039164 5:118791320-118791342 ATTCATCTATATATCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996039161 Original CRISPR AAAACTTTCTTCACAAAAAT AGG (reversed) Intergenic