ID: 996039161 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:118791277-118791299 |
Sequence | AAAACTTTCTTCACAAAAAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
996039161_996039164 | 20 | Left | 996039161 | 5:118791277-118791299 | CCTATTTTTGTGAAGAAAGTTTT | No data | ||
Right | 996039164 | 5:118791320-118791342 | ATTCATCTATATATCACCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
996039161 | Original CRISPR | AAAACTTTCTTCACAAAAAT AGG (reversed) | Intergenic | ||