ID: 996041307

View in Genome Browser
Species Human (GRCh38)
Location 5:118815625-118815647
Sequence GCTAATACTGCATGAAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996041301_996041307 14 Left 996041301 5:118815588-118815610 CCTCAAAATAACTAAGGCCATAT No data
Right 996041307 5:118815625-118815647 GCTAATACTGCATGAAATGGGGG No data
996041302_996041307 -3 Left 996041302 5:118815605-118815627 CCATATGTAACAAAACCACAGCT No data
Right 996041307 5:118815625-118815647 GCTAATACTGCATGAAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996041307 Original CRISPR GCTAATACTGCATGAAATGG GGG Intergenic
No off target data available for this crispr