ID: 996043045

View in Genome Browser
Species Human (GRCh38)
Location 5:118838070-118838092
Sequence TTATAAGACTTATGTGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996043045 Original CRISPR TTATAAGACTTATGTGGAAT AGG (reversed) Intronic
900909955 1:5588253-5588275 ATATAATACTTATTTGTAATTGG - Intergenic
901892937 1:12283587-12283609 ATATTAGACTTTTTTGGAATCGG + Exonic
903078878 1:20793040-20793062 TTAAAAAAGTTATGTGGAAGTGG + Intergenic
904437662 1:30509079-30509101 ATATAAAACATTTGTGGAATTGG - Intergenic
906538516 1:46566213-46566235 TTATATGAAATATCTGGAATGGG - Intronic
907769537 1:57446719-57446741 TTATATGAAATATCTGGAATTGG + Intronic
909238780 1:73184904-73184926 TTATAAAAGTTATGTGAATTAGG + Intergenic
909603793 1:77488350-77488372 TATTAAAACTTATGTGGAAAAGG - Intronic
910369383 1:86499993-86500015 TTTTAAAAATTATGTGGAAGTGG + Exonic
911048138 1:93645765-93645787 TTATAATATTTATGTTTAATTGG + Intronic
911455580 1:98118678-98118700 TTCTCAGACTGATGTGGAAATGG + Intergenic
911663817 1:100532391-100532413 ATAAATTACTTATGTGGAATTGG - Intergenic
911699228 1:100932082-100932104 TTCTAAAACTTTTGTGGAAAAGG - Intronic
912258598 1:108086139-108086161 TTGTAAGCATTATGTGGACTGGG + Intergenic
913040111 1:115013785-115013807 TTATATGACATATGTATAATAGG - Intergenic
915957099 1:160230179-160230201 TAATAAGAATCATGGGGAATAGG - Intronic
916355499 1:163902011-163902033 TTATAAAATTCATATGGAATTGG + Intergenic
919127490 1:193413456-193413478 ATATAAGACTTATCTGGAAATGG + Intergenic
919324669 1:196091437-196091459 TTACATAACGTATGTGGAATGGG + Intergenic
919960619 1:202464461-202464483 TTAAAACACTTAAATGGAATGGG - Intronic
922908526 1:229195842-229195864 TTATATGAAATATCTGGAATAGG + Intergenic
1063573971 10:7244399-7244421 TTGGAAGACTGATGTGTAATCGG - Intronic
1063841746 10:10080274-10080296 TTATAAGACATATAAGAAATGGG - Intergenic
1065065685 10:21961501-21961523 TTATAAGAAATATCTAGAATAGG + Intronic
1066002252 10:31115550-31115572 TTATACTACTCATGTGGATTCGG - Intergenic
1066670501 10:37832783-37832805 TTATAAGACTTCTCTCCAATAGG + Exonic
1067241824 10:44502831-44502853 TTATAAAACTCATGTAAAATAGG - Intergenic
1067929051 10:50541198-50541220 TTATAAAACTTAACTAGAATCGG - Intronic
1068224674 10:54091803-54091825 TTATAAGACTTATTTTATATTGG + Intronic
1069098802 10:64292428-64292450 TTATAAATCTTGTATGGAATTGG + Intergenic
1069111229 10:64449641-64449663 TTGTAAAACTTATATGGAAATGG + Intergenic
1074349327 10:112719962-112719984 TTATAAGAAATATCTAGAATAGG - Intronic
1074959858 10:118433459-118433481 TTACAAAACTTAATTGGAATAGG - Intergenic
1076644284 10:131941651-131941673 CTCCAAGACTAATGTGGAATGGG - Intronic
1082252657 11:49998725-49998747 TTATAAGATTTATCTCTAATTGG - Intergenic
1082678452 11:56139159-56139181 TGATAAGACTTATTTGGACCAGG - Intergenic
1085161474 11:74351037-74351059 TTATATGACATATGTAGAATAGG - Intronic
1085300475 11:75455559-75455581 CTAGAAGACGGATGTGGAATAGG - Intronic
1085886521 11:80529124-80529146 TCATAAAAGTTATGTGAAATCGG + Intergenic
1086529789 11:87771209-87771231 TTATAAGACTGATGTGTTAATGG + Intergenic
1087184981 11:95180461-95180483 TAATAAGATTTATCTGAAATTGG - Intronic
1087856291 11:103095482-103095504 TAATAATACTTATGCTGAATAGG + Intergenic
1088524896 11:110741889-110741911 TTATAAGCACTGTGTGGAATTGG - Intergenic
1089727872 11:120498746-120498768 TTATATGAAATATGTAGAATAGG + Intergenic
1090155419 11:124432548-124432570 TTATAGGACTGATGAGAAATTGG - Intergenic
1090663391 11:128898144-128898166 TTCTAAAACTTATGTGAAAAGGG - Intronic
1090677656 11:129016701-129016723 TTCTAAAATTTATGTGAAATGGG - Intronic
1093548947 12:20383867-20383889 TTACCAGCCTTATGTTGAATAGG + Intronic
1094702601 12:32884513-32884535 ATATAAGTTTTATGTGGCATGGG - Intronic
1094772647 12:33683245-33683267 TTATAAGATATATGTGGAATTGG + Intergenic
1095374236 12:41507067-41507089 TATTAAGACTCATGTGGAAGTGG + Intronic
1095806953 12:46330224-46330246 TTATATGACATGTCTGGAATAGG + Intergenic
1096395892 12:51266541-51266563 TAATAAGAGTTATGTGAAAATGG - Intronic
1097240843 12:57574235-57574257 TTATAAGATTTATTTGTAAGTGG + Intronic
1098448824 12:70595809-70595831 TCATGGGACTTCTGTGGAATTGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1099741422 12:86640418-86640440 TTTTAAGAATTCTGTGGGATCGG + Intronic
1102955825 12:117058319-117058341 TTACATGAATTATCTGGAATAGG + Intronic
1105432650 13:20351308-20351330 TTATAAGAAATGTGTGGAATAGG + Intergenic
1105774963 13:23650518-23650540 TTATATGACATATGCAGAATAGG + Intronic
1105990729 13:25618092-25618114 GCATAAGACTTATGTCAAATAGG - Intronic
1106164265 13:27228339-27228361 TTATATGACATATCTAGAATAGG - Intergenic
1106265872 13:28109471-28109493 CTATTAGACTTCTTTGGAATGGG - Intergenic
1106443012 13:29796461-29796483 TTATAAGAATTATAGGTAATTGG - Intronic
1107056185 13:36106725-36106747 TGATAGGATTTATTTGGAATGGG - Intronic
1107250579 13:38355987-38356009 TTATAAGAATTATGGGGGATCGG + Intronic
1107301577 13:38971625-38971647 TTAAAAGACTTATGTGGGCTGGG + Intronic
1108472388 13:50780592-50780614 TCATTTGCCTTATGTGGAATTGG + Intronic
1109117896 13:58412380-58412402 TTCTAAAATTAATGTGGAATTGG + Intergenic
1111953785 13:94733321-94733343 TTGTAAGAGTTATTTGAAATAGG + Intergenic
1112308780 13:98299492-98299514 TTATGAGTCTTCTGTAGAATAGG - Intronic
1112869273 13:103949929-103949951 TTATAAGACTAAGCTGGAAATGG - Intergenic
1112914707 13:104533825-104533847 TTATATTAATTCTGTGGAATAGG - Intergenic
1113119680 13:106912941-106912963 TTGAAAGATTTCTGTGGAATGGG - Intergenic
1114574112 14:23696794-23696816 CTCTAAGACTCATGTGGGATGGG + Intergenic
1115040302 14:28916406-28916428 TAATAAGATTTATGTGAGATAGG + Intergenic
1115660244 14:35487201-35487223 TTATATGAAATATGTAGAATAGG - Intergenic
1115831217 14:37344167-37344189 TTATAATATTTATGAGGTATTGG - Intronic
1115998823 14:39220813-39220835 TTATAACAATTATGAGTAATTGG - Intergenic
1117481656 14:56151867-56151889 CTATAAGACTTAGGTGTCATTGG - Intronic
1117661238 14:58006981-58007003 TTATAAGCCTTAAGTAGATTTGG - Intronic
1120963610 14:90148275-90148297 TTATAAGATTTATGTTTTATAGG - Intronic
1122912033 14:104835023-104835045 TTATATGACACATCTGGAATAGG - Intergenic
1122963121 14:105108225-105108247 TTATATGACTTATGAGGACTAGG + Intergenic
1125103771 15:35946882-35946904 TTATGAGACTGATGGGGTATAGG + Intergenic
1125458448 15:39885301-39885323 ATATATTTCTTATGTGGAATTGG - Intronic
1127942394 15:63712329-63712351 TTTTAAGACTTAACTGGATTGGG + Intronic
1129001155 15:72335431-72335453 TTATCAGCCTTATTTGGAATTGG + Intronic
1130111441 15:80968710-80968732 TTATAATACTTCTCTGAAATGGG + Intronic
1130413558 15:83668916-83668938 TTAAAAGACTCATGTGCATTTGG - Intronic
1130627000 15:85525736-85525758 TTTTAAGACCTATGTAGGATTGG + Intronic
1137871763 16:51956493-51956515 TTAAATGACTTATGTCAAATAGG + Intergenic
1138457222 16:57128107-57128129 TTATGAGACCCATGTGGAGTGGG + Intronic
1139315312 16:66062587-66062609 CTACAAGACTTACATGGAATGGG + Intergenic
1140930534 16:79623543-79623565 TAAATAGACTTTTGTGGAATGGG - Intergenic
1141724244 16:85775949-85775971 TCTGAAGACTTCTGTGGAATAGG - Intronic
1144351025 17:14396528-14396550 CTTTAAGATTTATTTGGAATTGG + Intergenic
1144470407 17:15535153-15535175 TAATAAGAAGTATGTGGGATGGG - Intronic
1144748143 17:17629556-17629578 TTATGTGAAATATGTGGAATAGG - Intergenic
1144925933 17:18808519-18808541 TAATAAGAAGTATGTGGGATGGG + Intergenic
1145980633 17:29009297-29009319 TCATAAGACTTATTTGGGCTAGG - Intronic
1147749407 17:42720031-42720053 TTATATGTCTCATGTGAAATTGG - Intronic
1149197090 17:54134028-54134050 TTATGAAATATATGTGGAATTGG + Intergenic
1149383460 17:56117948-56117970 TTATAAGAAATGTGTGGAATGGG - Intronic
1149389732 17:56176663-56176685 TTTTAAGACTTATGTGCAAATGG + Intronic
1150955461 17:69854489-69854511 TTATCAGGCTTAACTGGAATTGG + Intergenic
1151023294 17:70645066-70645088 TTAAAAGACTTATTTAGAAACGG - Intergenic
1152541259 17:80977435-80977457 TTATATGACATATCTGGAATAGG + Intergenic
1152707446 17:81852010-81852032 TTTTAATACTTCTGTGGAAATGG - Intronic
1153365505 18:4251225-4251247 TTATAAGATTTATGTCTAAGAGG - Intronic
1153608406 18:6856836-6856858 TAATTAGACTTATATGAAATGGG - Intronic
1155489629 18:26387461-26387483 TCATAAGATTTTTGCGGAATGGG - Intronic
1157390411 18:47297667-47297689 TTATAAGACATATCTAGAATAGG - Intergenic
1157631050 18:49096128-49096150 TTAAAAAAATTATCTGGAATAGG + Intronic
1158192144 18:54842196-54842218 TTAGAAAACGAATGTGGAATTGG + Intronic
1158623510 18:59052226-59052248 TTTCAAGGCATATGTGGAATTGG - Intergenic
1158716837 18:59888206-59888228 TTAAAAAACTAATGTGGTATCGG + Intergenic
1158827454 18:61239357-61239379 AAATAAGACGTATGTGGAAAAGG + Intergenic
1159425088 18:68274891-68274913 TTTTAATACATATGTAGAATTGG - Intergenic
1160435381 18:78848113-78848135 TTACAACACTTAAGTGGAAAAGG + Intergenic
1165377737 19:35454940-35454962 TGATTAGACCTAAGTGGAATGGG - Intergenic
1166033398 19:40149836-40149858 TTATATGAAATATCTGGAATAGG + Intergenic
926499043 2:13629711-13629733 TCATATGAATTATGTGTAATAGG + Intergenic
927647910 2:24890375-24890397 TGATAAAATTTATGTGGAATTGG + Intronic
928491496 2:31788500-31788522 TTATATGCCTTAGGTGGTATGGG - Intergenic
930049414 2:47203105-47203127 TTATATGAAATATCTGGAATAGG + Intergenic
930991752 2:57664497-57664519 TTTTAAGAGTTATGTCAAATTGG - Intergenic
931522676 2:63116694-63116716 ATATAAGTTTTATGTGGCATGGG + Intergenic
931532090 2:63227306-63227328 TTTTAATACTAATGTGGAACTGG - Intronic
933756445 2:85642806-85642828 TTATCAGACTTATGGTGATTAGG + Intronic
935410093 2:102752395-102752417 TTATTATACATATGTGGTATGGG - Intronic
937584802 2:123533930-123533952 TAATCAGAATTTTGTGGAATGGG + Intergenic
939131443 2:138240658-138240680 TAATAATACTTATTTGGAACAGG + Intergenic
939251562 2:139687302-139687324 TTATATGAAATATCTGGAATAGG - Intergenic
939430331 2:142096661-142096683 TTGTAAGGCCTCTGTGGAATAGG - Intronic
940949077 2:159651761-159651783 TTATATAAAATATGTGGAATAGG - Intergenic
942668342 2:178346847-178346869 TTAAAAGAGGTACGTGGAATGGG - Intronic
942746146 2:179235508-179235530 TTATAATACGTATGTGGGTTTGG - Intronic
943705334 2:191028032-191028054 TTTTAAAACTTCTGTGAAATAGG + Intergenic
944367823 2:198945028-198945050 TAATAAGACTTTTGTCAAATGGG + Intergenic
947539001 2:230961615-230961637 ATATAAGATTTATGTGTCATGGG + Intergenic
1170445900 20:16427346-16427368 TCATGATACTTATGTGGAAAAGG - Intronic
1170912778 20:20591504-20591526 TTATAGAACTTAAGTGGAAAAGG - Intronic
1170925411 20:20718444-20718466 TTCTAAAATTTATATGGAATTGG - Intergenic
1171911240 20:30958302-30958324 TTACAGGACTACTGTGGAATAGG - Intergenic
1177131006 21:17255531-17255553 ATAAAAGACTTATGTTGAAAAGG + Intergenic
1177482868 21:21714745-21714767 TTATAGGATATATGTGGGATTGG + Intergenic
1180506043 22:16005446-16005468 TTTGAAGCCTTATGTGGAAAAGG - Intergenic
1183888081 22:40901777-40901799 TTATATGAAATATGCGGAATAGG + Intronic
1184056374 22:42053055-42053077 TTATAAGAAATGTCTGGAATAGG - Intronic
1184843562 22:47066811-47066833 TTAAAATACAGATGTGGAATGGG - Intronic
1203332614 22_KI270739v1_random:16601-16623 TTTGAAGCCTTATGTGGAAAAGG + Intergenic
951744737 3:25965457-25965479 TTATAAGGTTTATGTAGAAATGG - Intergenic
951924694 3:27896000-27896022 TTATATGAAATATCTGGAATAGG + Intergenic
954649465 3:52151796-52151818 TGATAGGAATTATGTGGAATCGG - Intronic
955108270 3:55921770-55921792 TTCTAGGAATTATGTGCAATTGG + Intronic
955127006 3:56122761-56122783 TTATAAGACTTACGGGCATTCGG - Intronic
958800695 3:98752148-98752170 TTACAAGTTTTATGTGGCATGGG + Intronic
959000207 3:100955576-100955598 TTAGAAGACATCTGTGAAATGGG - Intronic
959003901 3:100997346-100997368 TAATATGACTTATTTGAAATGGG + Intergenic
959194387 3:103159955-103159977 TTATTACACTTATCTGGAAGGGG + Intergenic
959714134 3:109414045-109414067 TTTTGAGACTTATTAGGAATGGG - Intergenic
960048040 3:113215635-113215657 TTATAGGACTCATGGAGAATGGG - Intronic
960555311 3:119022206-119022228 TTATATGAGGTATCTGGAATAGG + Intronic
960873061 3:122269749-122269771 CTGTAAGACTTTTGTAGAATTGG + Intronic
961192730 3:124975744-124975766 TTATATGACTTATCTGAAATAGG - Intronic
962237511 3:133719027-133719049 TTATGACACTTAGGTGGAAATGG - Intergenic
962812802 3:138973668-138973690 GTATAAGCCTTAGGAGGAATTGG + Intergenic
963713333 3:148773248-148773270 TTATAAGCCTGAGGTTGAATAGG - Intergenic
966272676 3:178126920-178126942 TTATAAAACTTCTCTGAAATAGG - Intergenic
970126119 4:12813393-12813415 TTATCAGTATTATGTTGAATAGG - Intergenic
970490427 4:16567952-16567974 TTATAATACTGATTAGGAATTGG + Intronic
970850377 4:20595586-20595608 TTAAAATACTTATTTAGAATAGG - Intronic
970933966 4:21546316-21546338 TTACAAGATTTATATTGAATGGG + Intronic
971094599 4:23386484-23386506 GTAGAAAAATTATGTGGAATTGG + Intergenic
971577560 4:28295376-28295398 TTATAAGAATTGCATGGAATGGG + Intergenic
971615604 4:28787267-28787289 TTACAAGACAAATGTGGACTTGG - Intergenic
971782945 4:31061522-31061544 TTATAAAACTTTTCTGGACTTGG + Intronic
972003713 4:34071578-34071600 TAATAATACTTAAATGGAATTGG + Intergenic
972421240 4:38888657-38888679 TTATAAGAGTTATGGGGAGCAGG + Intronic
973640013 4:52893378-52893400 TTATATGAACAATGTGGAATGGG + Intronic
976238187 4:82923266-82923288 TGATAAAACTTATATGGAAAGGG - Intronic
976256371 4:83104835-83104857 TTATAATAATTATTTTGAATGGG + Intronic
976392446 4:84519135-84519157 TTATAAGTCTTAAGTAGAACTGG - Intergenic
978243490 4:106544583-106544605 TTCTAAAACTTCTGTGGAAATGG + Intergenic
978802678 4:112770403-112770425 TTATCAGATTTATGTGCATTAGG + Intergenic
981087955 4:140703006-140703028 TAATAAGACTTAGGGGTAATAGG + Intronic
981612995 4:146616106-146616128 TTATATCAATAATGTGGAATAGG - Intergenic
982631311 4:157832724-157832746 GTAAAGGAGTTATGTGGAATAGG + Intergenic
984209657 4:176830355-176830377 TTATATGAAATATCTGGAATAGG + Intergenic
984385127 4:179046693-179046715 TTATATGACTGAAGTAGAATGGG - Intergenic
986113400 5:4743832-4743854 TTATAGGAATTATATGAAATTGG + Intergenic
987519516 5:18962074-18962096 TTATAAGACCTTTGAGGACTTGG - Intergenic
987521045 5:18984062-18984084 TTAACACATTTATGTGGAATGGG - Intergenic
987701264 5:21402346-21402368 TTATAAAACTTTTGTGGATATGG - Intergenic
989302710 5:39912667-39912689 TGATAAAACTAATGTGTAATAGG + Intergenic
990554441 5:56916999-56917021 TTTTGAGACTTAATTGGAATAGG + Exonic
991133648 5:63155866-63155888 TCATAAGCCTTATGAGGAAAAGG + Intergenic
991170768 5:63622632-63622654 TTATAAGAAATATCTAGAATAGG - Intergenic
991270963 5:64780123-64780145 TTATAAGAAATATCTAGAATAGG - Intronic
992677908 5:79124064-79124086 TTATATGACATATCTAGAATGGG + Intronic
994471097 5:100209174-100209196 TTTCAAGACTTAATTGGAATGGG - Intergenic
995094479 5:108219164-108219186 CTAGAAGACTTGTGTTGAATTGG + Intronic
995097472 5:108255702-108255724 ATATAATATTTATGTGAAATAGG - Intronic
995430827 5:112074670-112074692 ATATAAGAGTTATGGGCAATGGG + Intergenic
995888992 5:116928890-116928912 TTATAATACTTTTGTACAATGGG + Intergenic
995965461 5:117902263-117902285 TTATAAAAGTTATTTGGAGTAGG + Intergenic
996043045 5:118838070-118838092 TTATAAGACTTATGTGGAATAGG - Intronic
996260218 5:121457815-121457837 TTATGAGACTTGGGTGGCATGGG - Intergenic
997856489 5:137377401-137377423 TTATAAGACTCAGGAGGAAGAGG - Intronic
998572759 5:143278757-143278779 TTATGAGACTTAGGTGAAACTGG + Intronic
998882663 5:146659399-146659421 TTTTTAGAGTTATGTGGACTTGG + Intronic
998971686 5:147599288-147599310 TTATAACCATTTTGTGGAATAGG + Intronic
1003151704 6:3557919-3557941 TTATATGAAATATCTGGAATGGG + Intergenic
1004670269 6:17789364-17789386 TTACAAGACTTTTGCTGAATAGG - Intronic
1008784254 6:55146190-55146212 TTATAAGATTTATATGGAATTGG + Intronic
1008923107 6:56863313-56863335 TTATAAGAAATATGTGTAAATGG - Intronic
1009676487 6:66830129-66830151 TCATACAACTTATGTGGAAAGGG - Intergenic
1010571684 6:77480793-77480815 TTAAAAGATTTATGTAGAGTTGG + Intergenic
1010881527 6:81179406-81179428 CTATAATACTTCTGTGGTATTGG + Intergenic
1011167772 6:84469035-84469057 TTAAAGGAGTTATGTGGAACTGG - Intergenic
1011739035 6:90341046-90341068 TTCTAAGCCTTTTGTAGAATTGG - Intergenic
1012342039 6:98139197-98139219 ATATAACAATTATGTGGCATTGG - Intergenic
1012443834 6:99288729-99288751 TTATCAGACTTCATTGGAATGGG - Intronic
1013320421 6:108982585-108982607 TTGGAACACTTATGTGGCATTGG - Intergenic
1013692577 6:112663341-112663363 ATATAAGACTTAACTTGAATGGG + Intergenic
1014497188 6:122139731-122139753 TTTTAAGAAGTATGTGGAAATGG + Intergenic
1016699677 6:147039798-147039820 TTTTAAGATATATGTGAAATAGG - Intergenic
1016793190 6:148088524-148088546 TTATATGACATGTCTGGAATAGG - Intergenic
1018233402 6:161698584-161698606 TTATCAGAATAATGTGGTATTGG + Intronic
1018583069 6:165324540-165324562 TTCTATGACTTATGTGTAATAGG - Intergenic
1021449053 7:20764649-20764671 TTATGAAACTAATGTGGACTAGG - Intronic
1022637749 7:32153322-32153344 TTATAGCATTTATCTGGAATGGG - Intronic
1023480295 7:40626675-40626697 TGAGAAAACTTATGGGGAATGGG + Intronic
1023530436 7:41148039-41148061 TTCTAAAAATGATGTGGAATGGG + Intergenic
1024371974 7:48596099-48596121 CTGTAAGATTTATGTGTAATAGG - Intronic
1024414318 7:49084467-49084489 TTTTAAAACTTATCTGTAATAGG - Intergenic
1024764160 7:52636988-52637010 TAATAAGACTTATGTGAATGTGG + Intergenic
1026410942 7:70122111-70122133 TTATAAGAGGTATCTAGAATAGG + Intronic
1027343587 7:77235189-77235211 ATATAAGACCTATGAGGAAAGGG - Intronic
1027581869 7:80006758-80006780 TTATAGAATTAATGTGGAATTGG + Intergenic
1027972851 7:85108233-85108255 TTATTAGACTTATGTATAAGAGG - Intronic
1031800568 7:126238833-126238855 TTACAAAATTTATCTGGAATTGG + Intergenic
1032676055 7:134130458-134130480 TTGTAAGACACATGTGGAACAGG + Intronic
1032831381 7:135630559-135630581 ATATATGACTTATTTGAAATTGG + Intronic
1033108316 7:138551374-138551396 TTAGAAATCTTATGTGGAAATGG - Intronic
1039924107 8:41913791-41913813 TTATAAGAGGTACCTGGAATAGG - Intergenic
1041312414 8:56530151-56530173 TTATAAGACTGATATTGAAATGG - Intergenic
1041872061 8:62646407-62646429 TTAAATGACTTATTTGGAGTTGG - Intronic
1042204600 8:66316480-66316502 TTATAAGAAATATCTAGAATAGG + Intergenic
1042358060 8:67851386-67851408 TACTAAGTGTTATGTGGAATAGG + Intergenic
1042465045 8:69119687-69119709 TTATAAAACTCATGAGGAAAAGG + Intergenic
1043385480 8:79743745-79743767 TTATGCGGCTTATGTGGAAAGGG - Intergenic
1045371175 8:101524698-101524720 TTATAAGAGTTCTTTGAAATGGG + Intronic
1046482004 8:114833816-114833838 TTCTAAAACTTTTGTGGAAATGG - Intergenic
1047557458 8:125948032-125948054 TTATGGGACTTTTTTGGAATAGG - Intergenic
1048481826 8:134803564-134803586 TTATAAGACTTATTTGGGGATGG - Intergenic
1050582211 9:7071306-7071328 TTCTAAAATTTATGTGGAAAGGG + Intronic
1050772999 9:9227055-9227077 TTATAATACTTTGGTGAAATAGG + Intronic
1050835366 9:10071274-10071296 TTGTAAAATTTATGTGGAAAGGG + Intronic
1050846588 9:10228591-10228613 TTACAAGAATCATGAGGAATAGG - Intronic
1050979747 9:11995686-11995708 TTAGAAGACATATTTTGAATGGG - Intergenic
1051213797 9:14774943-14774965 AAATAAGATTTATGTGGAGTGGG + Intronic
1052288569 9:26816795-26816817 TTATATGAAATATGAGGAATAGG + Intergenic
1055122634 9:72679860-72679882 TGATAAGACCTCTGTGAAATAGG - Intronic
1059497592 9:114722330-114722352 TTATAAGAAATATCTAGAATAGG - Intergenic
1203357852 Un_KI270442v1:177793-177815 TTAGAGGACTACTGTGGAATAGG + Intergenic
1186584650 X:10859757-10859779 CTAAAAGACTGATGAGGAATGGG - Intergenic
1187065069 X:15826337-15826359 TTATAAGACTTCTGTTAACTAGG + Exonic
1187186246 X:16988951-16988973 TTATAAAATTTATATGGAAAGGG + Intronic
1190700685 X:52987325-52987347 TTCTAAAATTTATGTGGAAAGGG + Intronic
1192379280 X:70598828-70598850 TTATACGAAATATCTGGAATAGG + Intronic
1192413983 X:70961230-70961252 TTAAAAGACTTATTTAGAAATGG - Intergenic
1193558825 X:82991902-82991924 TTACAGGACTTGTGTGGAACTGG - Intergenic
1193979009 X:88158348-88158370 TTACAAAACTTAAGTGTAATGGG + Intergenic
1194815358 X:98434188-98434210 TTATAAAACTCATGTTGCATTGG + Intergenic
1195789720 X:108570237-108570259 TGATAAGACCAATGTGGAGTTGG + Intronic
1196254931 X:113506039-113506061 TTTTAAGATTTGTCTGGAATTGG + Intergenic
1196375410 X:115027458-115027480 TTATAAGATATATGTAGATTTGG - Intergenic
1197404565 X:126034245-126034267 TTCTCAGCCTTAGGTGGAATAGG + Intergenic
1198205870 X:134464248-134464270 TTGTAAGACTGATATGAAATTGG + Intronic
1198520867 X:137451083-137451105 TTCTAAGAGTTTTGAGGAATGGG - Intergenic
1200659798 Y:5944608-5944630 TTATGAGAATTATGCCGAATAGG - Intergenic
1201903284 Y:19064913-19064935 TCCTAAGAATTATGTGGATTGGG - Intergenic
1201914316 Y:19166326-19166348 TTTTAAAACTTTTGTGGAAATGG - Intergenic