ID: 996047887

View in Genome Browser
Species Human (GRCh38)
Location 5:118896649-118896671
Sequence ATAAAATATGTGGCCGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996047887 Original CRISPR ATAAAATATGTGGCCGAATA GGG Intronic
902094248 1:13929637-13929659 ATAAAATATGTGAACTAATTGGG + Intergenic
905887249 1:41497956-41497978 ATAGAACATGTGGCCTAAGAGGG - Intergenic
906855948 1:49304842-49304864 AATTAATATGTGGCCAAATATGG - Intronic
909266935 1:73571624-73571646 AAAAAATAAGTGGCAGAAAAGGG + Intergenic
912271382 1:108212684-108212706 ATTGAATATGTCTCCGAATAAGG - Intergenic
913003810 1:114608371-114608393 ATAATAAATGTGACAGAATAGGG - Intronic
916667113 1:166976101-166976123 TTAAAATATGAGGTAGAATAAGG + Intronic
922150112 1:222994303-222994325 AAAAAATATGTTTCTGAATAAGG - Intronic
1063986304 10:11506986-11507008 ATGATATATGTGGCCCAATTTGG - Intronic
1064554142 10:16531837-16531859 ATAAACTATGTGTCCAAACAGGG + Intergenic
1065681735 10:28242045-28242067 ATAAAAAATGTTGCAGACTATGG - Intronic
1069293615 10:66815050-66815072 TTAAAAAATGTTGGCGAATACGG - Intronic
1077945911 11:6898324-6898346 ATAAAATATGTCACTGGATATGG + Intergenic
1079072165 11:17356714-17356736 ATAAAAGATATTGCAGAATATGG - Exonic
1080054614 11:27893152-27893174 ATTAAACATGAGGCAGAATAAGG - Intergenic
1088776061 11:113084344-113084366 ATAAAATAGAGGGCTGAATACGG - Intronic
1090176159 11:124651587-124651609 ATAAAATATATGGCAAAAGATGG + Intronic
1093086788 12:14874387-14874409 ATAAAATATGTTAACCAATAGGG - Intronic
1094759868 12:33520117-33520139 ATAAAATATCTGAACAAATAGGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1096081831 12:48838559-48838581 AAAAAAAATGTGGCCGAGTGCGG + Intronic
1098454356 12:70655522-70655544 ACAAAATATGTGTCCTAAAATGG + Intronic
1100633890 12:96415681-96415703 ATAAAATATGTGCCAAAATTAGG - Intergenic
1101314427 12:103616256-103616278 ATAACACATGTGGCAGAACATGG - Intronic
1103145740 12:118594417-118594439 ATATAATATGTGAACTAATATGG - Intergenic
1103501012 12:121401663-121401685 ATTAAATTTGTGGCCCATTAAGG + Intronic
1108209815 13:48126648-48126670 ATAAAATATGTGGCTGGGTGCGG - Intergenic
1109756202 13:66763478-66763500 ATAAAATATTTGGCTGTATTGGG - Intronic
1110761957 13:79240675-79240697 AAAAAAAATGTAGCCAAATAGGG + Intergenic
1111205805 13:85009571-85009593 ATAAAATATGTGTCCCAGTTTGG - Intergenic
1111422404 13:88030725-88030747 GTAAAATATGTGTGCCAATAAGG - Intergenic
1112757626 13:102655950-102655972 GAAAAATATGTGGATGAATAAGG - Intronic
1112975001 13:105306418-105306440 ATAAAATATTTGGGAAAATACGG + Intergenic
1115057900 14:29153013-29153035 ATAAAAAATGAGGAGGAATAGGG + Intergenic
1116185374 14:41593562-41593584 ATAAACTATGTGGCAGATCAGGG - Intergenic
1119335236 14:73827892-73827914 ATAAAATATGTGGCCGGGCGTGG + Intergenic
1121684877 14:95828386-95828408 ATAAATTATAAGGCCAAATATGG - Intergenic
1124554845 15:30715674-30715696 ATAAAATAAATGGCCTAAAAAGG + Intronic
1125830153 15:42709880-42709902 ATAAATTAAGTGGCGGAAGAAGG - Intronic
1126800305 15:52292027-52292049 ATAAAATATGCGGCCGGGTGCGG - Intronic
1127505227 15:59591518-59591540 ATCAAATGAGTGGCAGAATAAGG - Intergenic
1128569633 15:68724591-68724613 AAAAAAACTGTGGCCGAATTGGG - Intronic
1131501029 15:92966618-92966640 ATAAAATGTATGGCTGGATATGG + Intronic
1133910108 16:10057962-10057984 ATAAAATACGTGGCCGGGTGTGG + Intronic
1135293031 16:21256485-21256507 TGGAAATATGTGGCCGAACATGG - Intronic
1138424763 16:56923755-56923777 ATACAATATGTGGCCTTATGTGG + Intergenic
1139856119 16:69981629-69981651 AAAAAAAAACTGGCCGAATATGG + Intergenic
1140398413 16:74648925-74648947 ATAAAAAATGTAGCCGAGTGTGG + Intronic
1149813479 17:59700929-59700951 ATAAAAGGTGTGGCAAAATATGG + Exonic
1152050940 17:77976636-77976658 ATAAAACTTGGGGCCGGATACGG + Intergenic
1152135934 17:78503473-78503495 AGAAAATATGTGGCCGAGCGTGG - Intronic
1154029532 18:10740681-10740703 ATAAAATATGTATGTGAATAGGG + Intronic
1155788989 18:29939827-29939849 AAACAATATGTGGCACAATATGG - Intergenic
1155807101 18:30185094-30185116 ATAAAATATCTGGCCAGAGATGG + Intergenic
1155987571 18:32246170-32246192 ATAAAATATGCGGCCGGGCATGG - Intronic
1156145939 18:34178084-34178106 ATATAATCTGTGGCAGCATAAGG + Intronic
1156942405 18:42784693-42784715 ATAAAAGATTTGACTGAATATGG - Intronic
1157744944 18:50127233-50127255 ATATAATAGGTGCCCAAATATGG - Intronic
1159532411 18:69671276-69671298 ATAAAAGAAGTAGCAGAATAAGG + Intronic
1159539649 18:69759120-69759142 ATAAAATATTTAACAGAATAAGG + Intronic
927269936 2:21195908-21195930 ATAAAATATTTCCCCGAATTAGG - Intergenic
928111727 2:28515966-28515988 ATAAAACATGTGCCTGACTATGG + Intronic
929141520 2:38670635-38670657 ATCAAATATGTGGTCAGATATGG - Intronic
931053662 2:58442685-58442707 ATGAAATATTTGCTCGAATAAGG - Intergenic
932243124 2:70173427-70173449 ATAAAAAATGTAGCCAAGTATGG - Intronic
938593949 2:132767593-132767615 TACAAATATGTGGCCGAAAAAGG + Intronic
938594227 2:132770213-132770235 TACAAATATGTGGCCGAAAAAGG + Intronic
942754480 2:179323496-179323518 ATAAATTATGTGGACACATAAGG - Intergenic
942857184 2:180562791-180562813 ATAATATATGTGCCTGAAAATGG - Intergenic
943135761 2:183910143-183910165 CTAAAAAATGAGGCGGAATATGG - Intergenic
945747353 2:213734478-213734500 ATAAAATATGCTGCTAAATATGG + Intronic
1173434764 20:43022719-43022741 ATAGAATATGTGGCCAAATGAGG + Intronic
1173794105 20:45846915-45846937 ATAAAACATGTGGCCGGGCACGG + Intronic
1174228017 20:49020599-49020621 ATAAAATAATTAGCCGAATGTGG - Intronic
1177625252 21:23651157-23651179 GTAAAAGATGTGGCCGGATGGGG + Intergenic
1178120404 21:29464058-29464080 AAGAAATATGTGGCCGGACATGG - Intronic
1180798265 22:18618421-18618443 AAAAAATATGTGGCTGGGTATGG - Intergenic
1181223454 22:21376844-21376866 AAAAAATATGTGGCTGGGTATGG + Intergenic
1183139263 22:35921133-35921155 ATAGAATAAGTGGTAGAATAGGG - Intronic
950590250 3:13931857-13931879 AGAAAATCTGTGGCTGAATTTGG - Intergenic
950710328 3:14809443-14809465 AGAAAATCTGTGGCTGAATTTGG - Intergenic
952018429 3:28987695-28987717 ATAAAATATGTTACTGAAAATGG + Intergenic
955975055 3:64471919-64471941 ATTAAACATGTGGCAGTATAGGG + Intergenic
958039756 3:88212653-88212675 ATAAAATATGATTCCAAATATGG + Intergenic
958163932 3:89854688-89854710 ATAAAATACGTAACCTAATATGG - Intergenic
960108663 3:113824420-113824442 ATAGAATATGGGGCCGAGCATGG + Intergenic
960649488 3:119930862-119930884 ATAAAATATGTGGCCAATAAAGG - Intronic
962871554 3:139498726-139498748 ATAAAAAGTGTGTCAGAATAAGG - Intergenic
963405268 3:144855163-144855185 AAAAAATATATGACCAAATATGG - Intergenic
963413734 3:144966593-144966615 ATAATATATATGGCCAAAGATGG + Intergenic
965761094 3:172077937-172077959 ATAAAATATGAGCCCTAATTTGG - Intronic
966561730 3:181328399-181328421 GTAAAAAATGAGGCCTAATAAGG + Intergenic
967399433 3:189044262-189044284 AAAAAAAATGTGGCCGGGTACGG + Intronic
970746412 4:19302086-19302108 ATAACAGATGCTGCCGAATAAGG + Intergenic
970940087 4:21621646-21621668 AAAAAAGAAGTGGCCGAACATGG - Intronic
974389759 4:61251094-61251116 ACAAATTATGTGGCAGAATTTGG + Intronic
979029001 4:115615482-115615504 TTAAAATATGAGGCAGCATATGG - Intergenic
981022514 4:140043534-140043556 TAAAAATATGTGGCAGAATGTGG - Intronic
983112228 4:163766438-163766460 AAAATATAAGTGGCTGAATATGG + Intronic
984385692 4:179054397-179054419 ATAAAATTTGTAGCCAATTATGG + Intergenic
986333576 5:6736049-6736071 AAAAAATATGTGGCCAGATGCGG - Intronic
987194067 5:15507614-15507636 ATAAAATATGTGACAGCATCTGG + Intronic
988574536 5:32408378-32408400 AGAAAATATGAAGCAGAATAAGG - Intronic
996047887 5:118896649-118896671 ATAAAATATGTGGCCGAATAGGG + Intronic
998911574 5:146966001-146966023 ATACAATATGTGGTCGGTTATGG + Intronic
1001365477 5:171134316-171134338 ATACAATATTTAGCCTAATAAGG + Intronic
1001637894 5:173225749-173225771 ATAAAATAAGTGGCTATATATGG - Intergenic
1001645531 5:173278938-173278960 CTAATATATGTGGCCAAATCTGG - Intergenic
1005416731 6:25607726-25607748 AAAAAATATGTGACGGAACATGG - Intronic
1008273241 6:49514538-49514560 TAAAAATATGTGGCTGCATATGG + Intronic
1011547226 6:88494501-88494523 AGAAAGTATGTGGCAGAACAGGG + Intergenic
1012270611 6:97205231-97205253 AAAAAATACGTGGCCGAGTATGG - Intronic
1013595377 6:111655918-111655940 AAAAAAAATGTAGCCGAATGTGG + Intergenic
1014981980 6:127955608-127955630 ATAAAAAATGTGGACCAGTATGG + Intergenic
1016630450 6:146223714-146223736 ATGAAATATGTGGCGGAGAAAGG - Intronic
1017589807 6:155966848-155966870 ATCAAACGTGTGGCTGAATAAGG - Intergenic
1018245635 6:161820381-161820403 ATAAAATATATGGGCAAAGATGG + Intronic
1020363730 7:7357368-7357390 ATAAAATATGTGGCCGGGCGGGG + Intronic
1021685950 7:23186028-23186050 ATAAGATATGTGGCTGGGTATGG - Intronic
1022266909 7:28765804-28765826 ATAAAGTATGTTTCCAAATATGG + Intronic
1025728814 7:64091949-64091971 AAAAAAAATCTGGCCGGATACGG + Intronic
1025951328 7:66147766-66147788 ATGAAAGCTGTGGCCGAACATGG + Intronic
1027979153 7:85195205-85195227 TTAAAATAAGGGGCAGAATAAGG - Intergenic
1031839842 7:126724697-126724719 TTAAAATATGTGCCTGAAAAGGG + Intronic
1032319275 7:130870825-130870847 ATAAAATATGTTGCAGAATGAGG - Intergenic
1032498247 7:132379139-132379161 ATAAAAGATCTGGCCGAGCACGG - Intronic
1035566366 8:643868-643890 ATAAGATGTGTGACCGAAAAAGG + Intronic
1037184799 8:16049697-16049719 ATGAAATATGTGGCCTAATTTGG - Intergenic
1041243342 8:55868225-55868247 CTAAAATATATGGCTGAATAAGG - Intergenic
1049140273 8:140948354-140948376 ACAAAATATGAGGCAGAACAGGG + Intronic
1050941616 9:11467791-11467813 ATAAAACATGAGGCATAATAGGG - Intergenic
1054767699 9:69056037-69056059 ATAAAATAATTAGCCGAGTATGG - Intronic
1055084024 9:72295800-72295822 ATAACATATTTGGCCATATATGG - Intergenic
1057724569 9:97559090-97559112 ATAAAAGATGTAGCCTCATATGG - Intronic
1058032436 9:100214944-100214966 ATTAACTATGTGGCCAAAGAAGG - Intronic
1059857898 9:118421409-118421431 ATAAAATATGTGTTGGAGTAGGG + Intergenic
1060185146 9:121559651-121559673 ATAAAATATTTGGCCGGGTGTGG - Intergenic
1188520754 X:31034901-31034923 ATAAAACATGTGGGAGAAAATGG - Intergenic
1188683074 X:33035638-33035660 TAAAAATATGTGTCCGATTAAGG - Intronic
1193815060 X:86095308-86095330 ATAAAATATGTGCTCAAAAATGG - Intergenic
1194311056 X:92307228-92307250 CTTAAATATGTGGCTGAATTTGG - Intronic
1194490729 X:94545267-94545289 ATAAAATAAGTGGCAAAAAAAGG - Intergenic
1196640236 X:118051248-118051270 ATAAAATTTATGGCCGGGTACGG + Intronic
1199514813 X:148664277-148664299 GTGAAATATGTGGCCAAAAAAGG - Intronic
1199849196 X:151713414-151713436 AAAAAATAAGTTGCAGAATATGG + Intergenic
1200619334 Y:5421520-5421542 CTTAAATATGTGGCTGAATTTGG - Intronic
1201618142 Y:15924585-15924607 AAAAAATATGTGGCCGGACGCGG + Intergenic
1201934137 Y:19387610-19387632 CTATAATATGTTGCAGAATATGG + Intergenic
1202045283 Y:20731257-20731279 ATAAAAAAAGTAGCCAAATATGG - Intergenic