ID: 996054329

View in Genome Browser
Species Human (GRCh38)
Location 5:118966740-118966762
Sequence CAATCAGAGGCCAGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7864
Summary {0: 3, 1: 22, 2: 178, 3: 1325, 4: 6336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996054324_996054329 11 Left 996054324 5:118966706-118966728 CCCTAACAGTTCTCCATAATTAC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG 0: 3
1: 22
2: 178
3: 1325
4: 6336
996054323_996054329 27 Left 996054323 5:118966690-118966712 CCTAGTATGTTGCTTTCCCTAAC 0: 1
1: 0
2: 0
3: 15
4: 109
Right 996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG 0: 3
1: 22
2: 178
3: 1325
4: 6336
996054326_996054329 -2 Left 996054326 5:118966719-118966741 CCATAATTACAAATTAAAAGTCA 0: 1
1: 0
2: 3
3: 56
4: 532
Right 996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG 0: 3
1: 22
2: 178
3: 1325
4: 6336
996054325_996054329 10 Left 996054325 5:118966707-118966729 CCTAACAGTTCTCCATAATTACA 0: 1
1: 0
2: 2
3: 22
4: 255
Right 996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG 0: 3
1: 22
2: 178
3: 1325
4: 6336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996054329 Original CRISPR CAATCAGAGGCCAGGCACAG TGG Intronic
Too many off-targets to display for this crispr