ID: 996055052

View in Genome Browser
Species Human (GRCh38)
Location 5:118973605-118973627
Sequence GGCTGCCGCGAGCAAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 2, 2: 5, 3: 30, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996055052_996055055 -10 Left 996055052 5:118973605-118973627 CCGCCTCCTTGCTCGCGGCAGCC 0: 1
1: 2
2: 5
3: 30
4: 260
Right 996055055 5:118973618-118973640 CGCGGCAGCCTCCTTGCTCGCGG 0: 2
1: 0
2: 0
3: 4
4: 79
996055052_996055058 8 Left 996055052 5:118973605-118973627 CCGCCTCCTTGCTCGCGGCAGCC 0: 1
1: 2
2: 5
3: 30
4: 260
Right 996055058 5:118973636-118973658 CGCGGCAGCCTCCTTGCTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996055052 Original CRISPR GGCTGCCGCGAGCAAGGAGG CGG (reversed) Intronic
900014678 1:139678-139700 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900044545 1:494880-494902 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900044944 1:498287-498309 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900065949 1:729786-729808 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900066348 1:733195-733217 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900066744 1:736601-736623 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900067142 1:740017-740039 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900168472 1:1254522-1254544 GGCGGCCGCGAGCGGGGCGGGGG - Intronic
900786756 1:4654606-4654628 GGCAGACGCGAGGAGGGAGGCGG + Intergenic
901475804 1:9488435-9488457 GGCTGCCAGGAGCAAGGATAGGG + Intergenic
902156629 1:14492907-14492929 GGCTGCAGCGAGCAAGTGGTGGG - Intergenic
903224131 1:21885304-21885326 GGCTGCAGTGAGCAGGGAGCTGG - Exonic
904379396 1:30101075-30101097 GGCTGCCCCGAGGAAGGAGGGGG - Intergenic
904392478 1:30195124-30195146 GGCTGCTGCTAGAAAGGATGGGG - Intergenic
904398555 1:30240481-30240503 GGCTGCAGGGAGAAAGGAGACGG - Intergenic
905061659 1:35145095-35145117 AGCTGCCAGGAGCAAGGTGGAGG + Intergenic
905205214 1:36339466-36339488 GGCTGCGGGGAGCAGGGAGGGGG + Intergenic
905367964 1:37465565-37465587 GGTTGCAGTGAGCCAGGAGGCGG + Intergenic
907312677 1:53548044-53548066 GGATGCGGCCAGCAGGGAGGCGG - Intronic
907422455 1:54356552-54356574 GGCGGCCGGGAGCTAGGCGGCGG + Intronic
908444281 1:64187099-64187121 GTCTGCCACGAGCATGGAGAAGG + Intergenic
909571937 1:77123615-77123637 GGCTGCCAGGAGCTGGGAGGAGG + Intronic
914678128 1:149919425-149919447 GGCTGCCAATAGCAAAGAGGTGG - Intergenic
915016840 1:152742364-152742386 TGATGCCAGGAGCAAGGAGGAGG - Intronic
915344890 1:155192448-155192470 GGCTGCTGCAGGGAAGGAGGCGG - Intronic
915524231 1:156466435-156466457 GGGCGCCAAGAGCAAGGAGGTGG + Exonic
919667058 1:200302351-200302373 GGCTGCTGCGACCCGGGAGGGGG + Intergenic
919780012 1:201215651-201215673 GGCTGCCTGGAGGAAGGACGGGG + Exonic
922101074 1:222477135-222477157 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
922262173 1:223952273-223952295 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
922584818 1:226725667-226725689 GGCTGGAGTGAGCAAGGAGGGGG - Intronic
1064079203 10:12294685-12294707 GGGTGCTGCAACCAAGGAGGTGG - Intergenic
1064850084 10:19700294-19700316 TGCTGCCTCGAGCAAGGAAAAGG - Intronic
1065447540 10:25818921-25818943 GGCTGGCGAGAGGAGGGAGGTGG - Intergenic
1066063957 10:31749360-31749382 GGCTGCCCCGAGGCAGCAGGTGG + Intergenic
1066733251 10:38451643-38451665 GGCTGCCGAGAGCCATGAGCTGG - Intergenic
1066994148 10:42547864-42547886 GGTTGCCAGGGGCAAGGAGGAGG + Intergenic
1069583011 10:69577922-69577944 GGCGGCCCTGAGCAGGGAGGGGG - Intergenic
1069591334 10:69644151-69644173 GGCTGCCGTGGTCTAGGAGGAGG + Intergenic
1070314267 10:75295306-75295328 GGCCGCCGCCCGCCAGGAGGAGG - Intergenic
1071729468 10:88233306-88233328 GGCTGCTGAGGGCAAGGAAGGGG + Intergenic
1072107884 10:92291284-92291306 GGCGGCGGAGAGCGAGGAGGAGG - Exonic
1073115685 10:101090194-101090216 GGCTGCCCTGAGCAAGGGGGCGG - Exonic
1073325570 10:102642667-102642689 CGCCGCCGCGAGGAAGGCGGCGG - Intergenic
1076970875 11:131355-131377 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1076971273 11:134778-134800 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1077211842 11:1374848-1374870 ATCAGCCGTGAGCAAGGAGGAGG - Intergenic
1079308513 11:19345161-19345183 GGCTGGCGGGAGGGAGGAGGAGG + Intergenic
1083176428 11:60952671-60952693 GGCTGCTGTGAGGAAGGAAGTGG + Intergenic
1083395965 11:62392196-62392218 GGCTGCCCAGGGCATGGAGGTGG - Exonic
1083623118 11:64058731-64058753 AGCTGCCGCTGGCAAGCAGGAGG - Intronic
1083680516 11:64349593-64349615 GGCGGCGACCAGCAAGGAGGAGG + Exonic
1083821019 11:65171418-65171440 GGCTGCAGCCGGCAAGGTGGGGG + Exonic
1084527490 11:69705850-69705872 GGCTGATGCGATCAGGGAGGTGG + Intergenic
1084659887 11:70540468-70540490 GGCTCCCGCGGGCAGGGAGGAGG - Intronic
1084860484 11:72014754-72014776 GGCTGCCACCAGCAAAGAGGTGG - Exonic
1089256980 11:117199270-117199292 GGCTTCCTCTAGCAGGGAGGGGG + Intergenic
1089455795 11:118625111-118625133 GGCTGAAGTGAGCAAGGAGGAGG - Intronic
1089630027 11:119778783-119778805 GGCTGCCTGCAGGAAGGAGGAGG - Intergenic
1089815154 11:121166290-121166312 AGCTGCCACCAGCAAGGTGGGGG + Intronic
1092128683 12:6093338-6093360 GGCTGCCCTGGGTAAGGAGGTGG - Intronic
1092236853 12:6815831-6815853 GGCTTCCGGGAGGAGGGAGGTGG + Intronic
1099070251 12:78037127-78037149 GGCTGCCCCCAGCAGGCAGGAGG - Intronic
1099989690 12:89709052-89709074 GGCTGCGGCGCTCACGGAGGTGG - Intronic
1100598695 12:96093594-96093616 GGCTTCATTGAGCAAGGAGGGGG + Intergenic
1101592882 12:106139126-106139148 GGCCGCCGTGAGCTGGGAGGGGG + Exonic
1102298590 12:111755654-111755676 GGCTGCAGCCTGTAAGGAGGAGG - Exonic
1104065954 12:125306110-125306132 GGCTGCCTGGTCCAAGGAGGTGG + Intronic
1104843165 12:131834279-131834301 GGCTGCCGGGAGGAGGGAGGAGG - Intronic
1104934729 12:132358396-132358418 GGCTGCTGTGAGCGTGGAGGGGG - Intergenic
1104946487 12:132417024-132417046 GGCTGCCGCCAGCAAGGGGGTGG - Intergenic
1105037103 12:132933523-132933545 GGCTGCAGCGAGGAAGGAGCTGG - Intronic
1105745617 13:23375108-23375130 GGCGGCCGCGAGGTAGGCGGTGG - Exonic
1106269360 13:28138707-28138729 CGCCGCCGCCAGCGAGGAGGAGG - Exonic
1111455612 13:88479665-88479687 GGCTGCAGTGAGCTATGAGGTGG + Intergenic
1113612717 13:111658960-111658982 GTCTGACTCCAGCAAGGAGGGGG + Intronic
1113849307 13:113408971-113408993 GGCTGCAGAGAGGAGGGAGGAGG + Intergenic
1118767073 14:68917019-68917041 GGGTGCTGTGAGCATGGAGGTGG - Intronic
1119474674 14:74920229-74920251 GACAGCCGCCAGCAAGGCGGTGG - Intronic
1119520234 14:75279479-75279501 GGCAGCCTGGAGCACGGAGGAGG + Intronic
1119644382 14:76337945-76337967 GGCTGCAGGAAGGAAGGAGGAGG - Intronic
1120815000 14:88846960-88846982 GGGTGGGACGAGCAAGGAGGAGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121472442 14:94165896-94165918 GGCTGCCTCCAGCCAGGAAGTGG - Intronic
1122263680 14:100537057-100537079 GGCTGCAGAGAGCAAGGCTGGGG + Intergenic
1125917117 15:43497706-43497728 GGCTGCCAGGAGCTAGGAGGAGG + Intronic
1128242895 15:66113489-66113511 CACTGCAGCGGGCAAGGAGGGGG - Intronic
1128582398 15:68818952-68818974 GGCGGCCGCGGGAGAGGAGGGGG - Intronic
1129832893 15:78682108-78682130 GGCTGCCTTGTGCAGGGAGGTGG + Intronic
1129947011 15:79547965-79547987 GCCTGCTGGGACCAAGGAGGCGG + Intergenic
1130105171 15:80923440-80923462 GGCTTCCATGAGCAGGGAGGTGG + Intronic
1130224415 15:82046316-82046338 GGCTGCGGCGAGCGCGGGGGTGG - Intergenic
1130654751 15:85784670-85784692 GGCTGCAGCCAGCAAGGAAATGG + Intronic
1130689273 15:86066555-86066577 GGCTGCCCAGAGTAGGGAGGAGG - Intergenic
1131098947 15:89673234-89673256 GGCTGCCTGGAGCATGGAGCCGG - Exonic
1133327256 16:4949279-4949301 GGGTGCAGAGAGCACGGAGGAGG - Intronic
1134064915 16:11221923-11221945 GGCTGCCTCTGGCCAGGAGGTGG + Intergenic
1134070058 16:11255371-11255393 GGGGGCCGCGGGCGAGGAGGAGG + Exonic
1134091898 16:11396001-11396023 GGCTGCTGGGAGTAAGGAGGGGG + Intronic
1135421254 16:22307107-22307129 GGCCGCTGTGAGCACGGAGGAGG - Intronic
1136576082 16:31126234-31126256 GGCTGCTGATAGCAATGAGGAGG + Intronic
1137237315 16:46626350-46626372 GGCTGGGGAGAGCAAGGAGGTGG + Intergenic
1138539547 16:57679975-57679997 GGATGCAGGGAGCAAAGAGGAGG - Intronic
1139582329 16:67880879-67880901 GGCTGCCTCCAGGAGGGAGGGGG - Exonic
1139645252 16:68324709-68324731 GGCTGCCGTGAGCAGGGTGAAGG + Exonic
1142243884 16:88959648-88959670 AGCTGCTGGGAGGAAGGAGGAGG - Intronic
1142448981 16:90162744-90162766 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1142449382 16:90166163-90166185 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1142457714 17:65718-65740 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142458115 17:69138-69160 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142458509 17:72545-72567 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142483655 17:233483-233505 GGCTGCCATGATCATGGAGGTGG - Intronic
1142810930 17:2395195-2395217 GGCTGCCGCGGGCAAGGGTGGGG + Exonic
1145733306 17:27210137-27210159 GGCTGCTGCGAGCTATGATGAGG - Intergenic
1146149907 17:30458531-30458553 GGCGGCAGGGAGCAGGGAGGTGG - Intronic
1146260785 17:31418953-31418975 GGGTGCCAAGAGCGAGGAGGAGG - Intronic
1147458176 17:40551700-40551722 GGTTGCAGCCAGCAAGGATGAGG + Intergenic
1147957693 17:44146016-44146038 GGCTGCCGGGGGCAGGGAGGTGG - Intronic
1148332776 17:46821928-46821950 GTCTGTCGCGGGGAAGGAGGAGG + Intronic
1148617850 17:49013959-49013981 GGCCGCAGCGCGCAAGGAAGGGG - Intronic
1148731515 17:49839690-49839712 GGCAGTCGAGTGCAAGGAGGTGG - Intronic
1149605931 17:57925338-57925360 GGCAGCCCCGAGCAATGAGATGG + Intronic
1149995815 17:61405464-61405486 GGCGGCCGAGGGCAAGGAGCAGG + Exonic
1150211626 17:63445278-63445300 GGCTCCCTCATGCAAGGAGGTGG + Intronic
1151838014 17:76596760-76596782 GGCTGCCATGAGCAGGGAGAGGG - Intergenic
1151877051 17:76872830-76872852 GCCTGCGGAGAGGAAGGAGGCGG - Exonic
1152071812 17:78137848-78137870 GGGTGCCGCGAGCATGTTGGGGG + Intronic
1152249115 17:79202383-79202405 GTCTGCCGTGAGCACAGAGGGGG - Intronic
1153716892 18:7859379-7859401 GGCTGCCACCAGCAAGGATCAGG - Intronic
1160647827 19:201644-201666 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1160648226 19:205058-205080 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1161086063 19:2335359-2335381 GGATGCAGTGAGAAAGGAGGCGG - Intronic
1161101565 19:2424415-2424437 GGCTGCAGGGAGCGAGGATGGGG - Intronic
1161125680 19:2556033-2556055 GGCTGCCGCGAAGCTGGAGGGGG - Intronic
1161409459 19:4108808-4108830 GCCTGCCGGGCGCGAGGAGGAGG + Intronic
1161520287 19:4720020-4720042 GGCTGCCTGGAGCAATGAGGAGG - Intronic
1161967127 19:7555042-7555064 GGCTGCGGCGCGAAAAGAGGCGG - Exonic
1162950644 19:14070357-14070379 GGACGCGGCGACCAAGGAGGAGG - Intergenic
1166457981 19:42960052-42960074 GGCTGCTGCAGCCAAGGAGGTGG + Intronic
1167036033 19:46995495-46995517 CTCTGCCGCGTGCAGGGAGGCGG + Intronic
1167357924 19:49015479-49015501 TGCTGCCTAGAGCATGGAGGTGG + Intronic
1168063463 19:53906930-53906952 GGCTGCCGCCGGCACGGCGGAGG - Exonic
1168643349 19:58044524-58044546 GGCCGCCGCGGAGAAGGAGGAGG + Intronic
1168645495 19:58056578-58056600 GGCTGACGGAAGCAAGGACGTGG + Intergenic
1168645524 19:58056702-58056724 GGCTGACGGAAGCAAGGACGTGG + Intergenic
925360819 2:3278829-3278851 GGCTGCCCTGTGCAGGGAGGAGG + Intronic
925388419 2:3479404-3479426 GGCTGTCGCCGGCAAGGAGGGGG + Exonic
925473053 2:4183353-4183375 GGCTGCAAGGAGGAAGGAGGAGG + Intergenic
925592021 2:5519387-5519409 GCCTGCCAGGAGCAGGGAGGTGG + Intergenic
925689507 2:6506613-6506635 GGCTGCCAGGAACAAGAAGGAGG + Intergenic
926142654 2:10377581-10377603 GGCTGCCGAGAGCTGGCAGGGGG - Intronic
926186320 2:10693561-10693583 GGTTGCAGTGAGCCAGGAGGTGG + Intergenic
926801839 2:16665912-16665934 GGCTGCCGCGAGCCGGGCTGGGG - Intronic
927751440 2:25673660-25673682 GGCTTCCGCGCGCGGGGAGGGGG + Intergenic
927846525 2:26475171-26475193 GGCTGCCGCAAGCAGGCAGGAGG + Intronic
928421121 2:31138407-31138429 GGCGGCAGCGGGCAAGGCGGCGG - Intronic
929849849 2:45576131-45576153 GGCTGACGAGAAAAAGGAGGAGG - Intronic
931274871 2:60735746-60735768 GGCGGCCGCGGGGACGGAGGCGG + Intergenic
935938254 2:108209794-108209816 GGGTGCTGCAACCAAGGAGGTGG - Intergenic
937412032 2:121685100-121685122 AGCTGCCGGGAGCAAGGTGGTGG + Intergenic
944882871 2:204032237-204032259 GGCTGCCGGGAGTATGGTGGGGG - Intergenic
946391311 2:219418423-219418445 GGCTGGCGGGCGCACGGAGGAGG - Exonic
947598748 2:231431365-231431387 GGGTGACGCCAGGAAGGAGGGGG + Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
947744872 2:232502285-232502307 GGCTGCCACGGGCAAGGGGAGGG + Intergenic
948436782 2:237959192-237959214 GGCTGCAGAAAGCAAGGAAGGGG - Intergenic
948631167 2:239303503-239303525 GGCTGTCCCGAGAAAGGAGCGGG - Intronic
1169065709 20:2693235-2693257 AGCTGCCTCGGGCAAGGCGGGGG - Intronic
1169908827 20:10630476-10630498 GGCAGCCTCCAGCCAGGAGGTGG + Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1174163699 20:48569762-48569784 GGCTTCAGCCAGCAAGCAGGCGG + Intergenic
1176022944 20:62971324-62971346 GGCAGCCGAAAGCCAGGAGGAGG + Intergenic
1176112602 20:63417445-63417467 AGCTGCCGTGAGAAAGGAGGTGG - Intronic
1178880641 21:36447451-36447473 GGCTGCAGTCAGGAAGGAGGAGG - Intergenic
1179716439 21:43291108-43291130 GGCCGCCGGGAGGAAGGCGGTGG - Intergenic
1179873286 21:44254522-44254544 GGATGAGGCGGGCAAGGAGGCGG - Intronic
1179926766 21:44539144-44539166 GGCTCCTGGGAGCAAGGAGGGGG + Exonic
1180706940 22:17815992-17816014 GGTTGCCCCCAGCCAGGAGGAGG + Intronic
1180734995 22:18009803-18009825 GGCTGCTGCGAGCTATGATGAGG + Intronic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1182269607 22:29145189-29145211 GGCTTCCAGGAGCATGGAGGAGG + Intronic
1182476061 22:30576924-30576946 GGCTGGCTGGAGAAAGGAGGAGG + Exonic
1185101787 22:48844541-48844563 GGCTCCCGCGTGCTAGGAGGAGG + Intronic
950447423 3:13046419-13046441 GGCTGCAGGGAGCGAGGGGGTGG - Intronic
951334538 3:21405755-21405777 GGCTGCTGCCAGCCACGAGGTGG - Intergenic
954034046 3:47840991-47841013 AGCTGCCGCCAGGAAGTAGGGGG - Exonic
954784890 3:53085331-53085353 GGATGCCAGGAGCAGGGAGGTGG - Intronic
954786806 3:53099388-53099410 TGCTGCCATGAGCAAAGAGGAGG - Exonic
955221576 3:57027474-57027496 GTCTGCAGGGAGCAAGTAGGAGG + Intronic
956736708 3:72244082-72244104 TGCTGGGGAGAGCAAGGAGGTGG - Intergenic
959090089 3:101893162-101893184 GGCTGCCAGGAGCTAGGGGGAGG - Intergenic
961275064 3:125719920-125719942 TGATACCGGGAGCAAGGAGGCGG - Intergenic
961277980 3:125742549-125742571 TGATACCGGGAGCAAGGAGGCGG - Intergenic
961305703 3:125958296-125958318 GGCTGCCGCGAGCTAGGCGCTGG + Intergenic
961750434 3:129091042-129091064 GGCTGGGGAGAGCAAGGAGGTGG + Exonic
964303851 3:155319793-155319815 GGTTGCTGGGAGCCAGGAGGTGG - Intergenic
964499455 3:157332401-157332423 GGTTGCCAAGAGCTAGGAGGAGG - Intronic
967297308 3:187977974-187977996 TGCAGCTGCCAGCAAGGAGGTGG - Intergenic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968353432 3:198081081-198081103 GGCTGCTGCGAGCAGGCAGAGGG + Intergenic
968369620 3:198215057-198215079 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
968370020 3:198218471-198218493 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
968509507 4:989210-989232 GGCTGCCAGGAGGAAGGAGGGGG - Exonic
968614626 4:1571767-1571789 GGGTGCATCGTGCAAGGAGGTGG + Intergenic
969427932 4:7136785-7136807 GTCTGCCGCGAGCAGGCAGGGGG + Intergenic
969633643 4:8352850-8352872 AGCTGCCTCGAGCAATTAGGAGG + Intergenic
969921855 4:10547651-10547673 GGCTGCCAGGAGCAAGGAGGAGG - Intronic
973279297 4:48342020-48342042 GCCCGCCGCTAGCAAGGAGGTGG - Exonic
973718761 4:53702797-53702819 GGCTGCAGCGAGCAGGGGTGGGG - Intronic
973820623 4:54658757-54658779 GACTCCCGCGAGCCTGGAGGTGG + Intronic
975035683 4:69677326-69677348 GGCTGGAGGGAGGAAGGAGGTGG + Intergenic
977511227 4:97965268-97965290 GGCTGCAGCCAGCCAGGGGGAGG + Intronic
979329630 4:119410120-119410142 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
980999023 4:139810253-139810275 GGCTGCAGCGAGCTATGATGGGG - Intronic
986068141 5:4256108-4256130 GGCTGGCTGGAGCAGGGAGGGGG - Intergenic
988442088 5:31244712-31244734 GGCTGCCTCGAGGAACAAGGTGG + Intronic
991131965 5:63132796-63132818 GACTGCAGAGAGCAAGGATGTGG - Intergenic
992944960 5:81801007-81801029 GACTGCCCCAAGGAAGGAGGAGG - Intergenic
996055052 5:118973605-118973627 GGCTGCCGCGAGCAAGGAGGCGG - Intronic
997390278 5:133509448-133509470 GGCTGAAATGAGCAAGGAGGAGG - Intronic
997539323 5:134648714-134648736 GGCTGCTGCGAGCCCGGAGCCGG + Intronic
997653008 5:135536026-135536048 GGCTGCCGCGGGGGCGGAGGTGG - Intergenic
1000358258 5:160421930-160421952 GGCTCCGGCGGGGAAGGAGGCGG + Exonic
1001035085 5:168291755-168291777 GGCTGCAGGGAGGAGGGAGGCGG + Intronic
1001706182 5:173742650-173742672 GGCTGCCTTGAGGGAGGAGGAGG - Intergenic
1001763299 5:174225085-174225107 GGCAGCCACGAGCCAGGAGGAGG - Intronic
1002047558 5:176550402-176550424 GGGTGCCCGGAGCAAGGATGTGG - Intronic
1002312609 5:178323732-178323754 CGCTGCAGGGAGCAGGGAGGTGG + Intronic
1002351910 5:178589649-178589671 GGCGGCCGCGAGAAAGGGGAAGG - Intronic
1002728900 5:181320642-181320664 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1002729299 5:181324049-181324071 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1004470381 6:15923630-15923652 GGCAGCTGGGAGAAAGGAGGAGG + Intergenic
1006060364 6:31414412-31414434 GGCCTCCTCGAGCAAGGTGGGGG + Intronic
1006072806 6:31509183-31509205 GGCCTCCTCGAGCAAGGTGGGGG + Intronic
1006105766 6:31715400-31715422 GGCTGCCTTGGGTAAGGAGGCGG + Exonic
1007602453 6:43091031-43091053 GGAAGCGGGGAGCAAGGAGGGGG - Intronic
1008582908 6:52922460-52922482 AGCTGCCGGGAGCAAGGTGGCGG - Intergenic
1012857030 6:104514273-104514295 GGCTGAAGCGGGCAAGGAAGAGG + Intergenic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1013793635 6:113860243-113860265 GGCGGCAGCGGGCGAGGAGGGGG + Exonic
1014126508 6:117782515-117782537 GGCTGCAGCGAGCTATGATGGGG - Intergenic
1014632435 6:123803570-123803592 GGCTGCTGCGCGCAATGATGCGG - Intergenic
1014750031 6:125245335-125245357 GTCTGCCTCCAGCCAGGAGGTGG + Intronic
1015889794 6:137958935-137958957 GGTTGCCAGGAGCTAGGAGGAGG - Intergenic
1015999580 6:139029259-139029281 GGCTGCCCCGAGGAACGTGGTGG + Intronic
1016239851 6:141917274-141917296 GGCAGCAGCGAGCATGGGGGAGG + Intergenic
1018434958 6:163751423-163751445 GGCTGCGGGGAGGGAGGAGGAGG - Intergenic
1019540856 7:1550394-1550416 GGCTGCAGGGAGCACAGAGGGGG + Exonic
1019731511 7:2631946-2631968 GGCGGCGGCGAACAAAGAGGCGG + Exonic
1020220498 7:6232934-6232956 GGCTGCAGGGAGGTAGGAGGTGG - Intronic
1021411343 7:20331874-20331896 GGCTGCCCAGAGGAACGAGGCGG - Exonic
1021992705 7:26152846-26152868 GGCTGCCGGGAGCGCGGACGAGG + Exonic
1022489351 7:30804909-30804931 GGATGCTGTGAGCAAAGAGGTGG + Intronic
1023016048 7:35969148-35969170 GGCTGCAGTGAGCCAGGATGGGG + Intergenic
1023400693 7:39791740-39791762 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1025053790 7:55748044-55748066 GGCTGCCGGGAGGTAGGAGTTGG + Intergenic
1025131895 7:56378518-56378540 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1025176186 7:56803606-56803628 GGCCACCGCGAGGCAGGAGGTGG + Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1030505611 7:110418122-110418144 GGCTGCAGTGAGCAAAGTGGAGG - Intergenic
1032051021 7:128651185-128651207 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1033113855 7:138607629-138607651 GGCTGCAGCCAGCTTGGAGGAGG + Intronic
1034495081 7:151415843-151415865 GGCTGCCCAGAGCTTGGAGGAGG + Intergenic
1035318920 7:158015848-158015870 GGAAGCCGCGATCGAGGAGGAGG + Intronic
1035344207 7:158188024-158188046 GGCTGCTGGGTGCATGGAGGAGG - Intronic
1035351100 7:158247090-158247112 GGCTGCCTCAAGGAATGAGGAGG + Intronic
1036544324 8:9751721-9751743 GGCAGCCGAGAGGCAGGAGGGGG - Exonic
1036782146 8:11657177-11657199 GGCTGTAGTGGGCAAGGAGGTGG - Intergenic
1037905949 8:22716110-22716132 GGCTGAAGGGAGAAAGGAGGAGG + Intronic
1039542296 8:38382214-38382236 GGCGGCGGCCAGCACGGAGGCGG - Exonic
1039946186 8:42130733-42130755 AGCTGCCAGGAGCTAGGAGGAGG - Intergenic
1045432206 8:102124367-102124389 TGCGGCCGCGAGGAGGGAGGCGG - Intronic
1046422690 8:114005881-114005903 GGCGGCCGCGAGGCTGGAGGAGG - Intergenic
1049015556 8:139917651-139917673 GGCTGCTGCGAAGATGGAGGCGG - Intronic
1049044978 8:140142546-140142568 AGCTGCTCCCAGCAAGGAGGTGG + Intronic
1049620730 8:143597359-143597381 GGACGCGGCGACCAAGGAGGAGG + Exonic
1051142003 9:13988015-13988037 GGCTGGCTGGAGAAAGGAGGAGG - Intergenic
1052970268 9:34373063-34373085 TGCTGCCGCAAGCTAAGAGGAGG + Intronic
1053142673 9:35690939-35690961 GGCTGCGGCGGGGAAGGCGGAGG + Exonic
1056572781 9:87830431-87830453 CTCTGCAGCCAGCAAGGAGGAGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1059414640 9:114155454-114155476 GGCGGCCGGGAGCGGGGAGGAGG + Intergenic
1060621626 9:125072697-125072719 GGCTGCCAGGGGCTAGGAGGAGG - Intronic
1062231965 9:135486859-135486881 GGGTGCCGCGAGCCAGGACGCGG + Exonic
1062379302 9:136279481-136279503 GGCTGCCCCTTCCAAGGAGGAGG + Intergenic
1062439839 9:136564727-136564749 GGCTGCCACGAGAAAGGAAAGGG + Intergenic
1062741372 9:138177207-138177229 GGATGCCACGGCCAAGGAGGAGG + Intergenic
1062753960 9:138277741-138277763 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203576479 Un_KI270745v1:12520-12542 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203576876 Un_KI270745v1:15929-15951 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203577278 Un_KI270745v1:19350-19372 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1191979723 X:66912509-66912531 GCCTGCCCCGGGCAAGGGGGAGG + Intergenic
1193819819 X:86148313-86148335 GGCTGCCGCTGGTGAGGAGGTGG - Intergenic
1199977318 X:152902036-152902058 GCCTGCCTGGAGCAGGGAGGTGG + Intergenic
1200120690 X:153788916-153788938 GGCTGCAGCCAGCCTGGAGGTGG - Intronic
1200211681 X:154349434-154349456 TGCTGACGCCAGCAAGGTGGTGG - Exonic