ID: 996057491 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:118997985-118998007 |
| Sequence | CTTTACATGCAAGATGTGTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996057491_996057493 | 21 | Left | 996057491 | 5:118997985-118998007 | CCTTACACATCTTGCATGTAAAG | No data | ||
| Right | 996057493 | 5:118998029-118998051 | CTAAAGTCATGTGAACTAAAAGG | 0: 13 1: 56 2: 138 3: 202 4: 333 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996057491 | Original CRISPR | CTTTACATGCAAGATGTGTA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||