ID: 996057491

View in Genome Browser
Species Human (GRCh38)
Location 5:118997985-118998007
Sequence CTTTACATGCAAGATGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996057491_996057493 21 Left 996057491 5:118997985-118998007 CCTTACACATCTTGCATGTAAAG No data
Right 996057493 5:118998029-118998051 CTAAAGTCATGTGAACTAAAAGG 0: 13
1: 56
2: 138
3: 202
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996057491 Original CRISPR CTTTACATGCAAGATGTGTA AGG (reversed) Intergenic
No off target data available for this crispr