ID: 996062849

View in Genome Browser
Species Human (GRCh38)
Location 5:119051070-119051092
Sequence CCTTTTCTTCAGGTGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996062849 Original CRISPR CCTTTTCTTCAGGTGATGGA AGG Intronic
906037315 1:42759480-42759502 CCTGTTCCTCAGGTTATGGATGG + Intronic
906380583 1:45329842-45329864 CCTTTTCTTCAGGTTTGGGAGGG - Intronic
906397006 1:45475106-45475128 CCTTTTCTTCTGATGTTAGAGGG + Intronic
907202474 1:52739386-52739408 CCTTTTCTTTAAGAGATGGAAGG - Intronic
911904368 1:103548122-103548144 CCTAGTCCTCAGGTGATGGGAGG + Intronic
914848829 1:151298948-151298970 CTGTTTCTTCACCTGATGGATGG + Exonic
914997122 1:152553677-152553699 CCTTTCCTAGGGGTGATGGACGG - Intronic
916074442 1:161192230-161192252 TCTTTTCCTCAGGTGGTAGATGG - Exonic
918514376 1:185346211-185346233 TCTTTTCTTCAGGTTTTAGAAGG + Intergenic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
920568463 1:206996280-206996302 CTTTGTCTTCACATGATGGAAGG - Intergenic
922417972 1:225439057-225439079 CCTTGTCTTCAGGTGTTGGCTGG - Intergenic
1063022850 10:2146800-2146822 CCTGCCCTCCAGGTGATGGAGGG + Intergenic
1063382686 10:5596094-5596116 TGTTTTCTGCAAGTGATGGATGG + Intergenic
1066473238 10:35719535-35719557 CCTTTTCATCAGCTTATAGAGGG - Intergenic
1067048170 10:42997540-42997562 CTGTTTCTGAAGGTGATGGAGGG - Intergenic
1067311913 10:45121646-45121668 CCTCTGCTTCCAGTGATGGATGG + Intergenic
1068384961 10:56314414-56314436 CCTTCTCTACAGGTGTTAGAGGG + Intergenic
1069026938 10:63552623-63552645 CCTTCTTTTCAGTTGATAGATGG + Intronic
1069215151 10:65811055-65811077 CTATTTCTGCAGGTGATGGTTGG - Intergenic
1070387830 10:75941795-75941817 CCTATTCCTCAAGAGATGGAAGG - Intronic
1071853896 10:89603797-89603819 CCCTTTCGTCATTTGATGGAGGG - Intronic
1072176431 10:92927256-92927278 CCTTTCCTTCTGATGTTGGATGG + Intronic
1072494483 10:95942536-95942558 CTTTTTCTTAAGGTGAAGAAGGG - Intergenic
1073755943 10:106580567-106580589 GCTTTGCTTAAGTTGATGGAAGG - Intronic
1074833194 10:117264049-117264071 CCTTTGCTTCCGGGGCTGGATGG + Intronic
1075699276 10:124458398-124458420 CCTTTCCTTCTGGTCATGGTGGG + Intergenic
1076585947 10:131547761-131547783 CCTTAGCTTCACGTGATGGAGGG - Intergenic
1077881189 11:6351744-6351766 TCATTTTTTGAGGTGATGGAGGG - Intergenic
1079960750 11:26920245-26920267 CCTTTTCTTCTTTTGATGGAGGG - Intergenic
1079996961 11:27305080-27305102 CCTTATCTTCAAGTCAGGGACGG + Intergenic
1080506202 11:32916455-32916477 CCCTTTTGTCAGGTGATGCATGG - Intronic
1080807886 11:35672408-35672430 CCTTTTCTTCAGGTGATCTTGGG - Intronic
1086497929 11:87422963-87422985 CCTTCTCTTCAGGTGATATTTGG + Intergenic
1086957838 11:92952120-92952142 CCTCTTCTTCAGGCGAAGAAGGG - Intergenic
1087148066 11:94831856-94831878 CTTTTTCTCCAGGAAATGGAAGG + Intronic
1087816644 11:102665483-102665505 CCTTTTCCTAAGTTGGTGGACGG - Intergenic
1088165334 11:106928191-106928213 CCTCTTCTACAGTGGATGGAAGG + Intronic
1088353063 11:108911432-108911454 TGTGTTCTTCACGTGATGGAGGG + Intronic
1092197868 12:6560777-6560799 TCTTTTCTCCAGGTGGTGGGGGG - Exonic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1092264417 12:6970185-6970207 CCTTCACTTCAGGTAATGGCGGG - Exonic
1094102935 12:26783070-26783092 CCTTTTCTTCAAGTAATTCAGGG - Intronic
1094799523 12:34016736-34016758 CTTTTTCTTCACATGATTGAAGG + Intergenic
1095112310 12:38311002-38311024 CTTTTTCTTCACATGATTGAAGG + Intergenic
1095412624 12:41940630-41940652 CCTCTTCTTCTGGTGACAGAGGG + Intergenic
1095417575 12:41993331-41993353 CATGTTCTTCACGTGATGGCAGG + Intergenic
1099091231 12:78311809-78311831 CCTTATGTTCACATGATGGAAGG - Intergenic
1099112960 12:78586368-78586390 GCTTGTCTTCAGGTGTTGGTGGG + Intergenic
1100116220 12:91307979-91308001 CTGTTTCTTCAAATGATGGAAGG + Intergenic
1100245875 12:92756486-92756508 CCTATGTTCCAGGTGATGGAGGG + Intronic
1101822054 12:108191800-108191822 CCTTTTCTCCTGGGGAGGGAAGG - Intronic
1101914303 12:108884547-108884569 CCTATGCTTGAGGGGATGGATGG - Intronic
1103120274 12:118374155-118374177 CCTTGACCTCAGGTGATGAATGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106989871 13:35406020-35406042 CTTTTTTTTCTGGAGATGGAGGG - Intronic
1106995745 13:35478298-35478320 CCTGCTCTTAAGGGGATGGAAGG - Intronic
1108188983 13:47917622-47917644 CCTGTTCCTCAGGTGGTGGGTGG - Intergenic
1108266140 13:48710901-48710923 CCTTTTTTTCAGGAAATGAAGGG + Exonic
1108518831 13:51226442-51226464 CATTCTCCTCAGATGATGGAGGG - Intronic
1109397228 13:61776050-61776072 ACTTTTCTTCAGGTAATAGAAGG - Intergenic
1109543919 13:63816809-63816831 CTTTTACTTCAGGTTCTGGATGG + Intergenic
1110024161 13:70512603-70512625 ACTTTTCTTGAGAGGATGGAAGG - Intergenic
1111098363 13:83544934-83544956 CTTTGCCTTCACGTGATGGAAGG + Intergenic
1111161187 13:84397442-84397464 GCTTTTCTTCATGTGATTGTTGG + Intergenic
1111657341 13:91170409-91170431 CCTTTTCTTTAAGTGATTGATGG - Intergenic
1113626166 13:111848809-111848831 CCTCTTCTTGGGGAGATGGAGGG + Intergenic
1115340730 14:32290945-32290967 CCATTGCTTCAGAAGATGGAAGG + Intergenic
1117327179 14:54680046-54680068 CCTTATCTTCAGATCATGGGTGG + Intronic
1117457254 14:55910963-55910985 CAGTTTCTTCAAGAGATGGAAGG - Intergenic
1119330835 14:73792353-73792375 CCTCTTCTCCAGGTCTTGGATGG + Intergenic
1119529845 14:75352431-75352453 CCTTTGCAGCAGGTGAGGGAGGG + Intergenic
1119634514 14:76263084-76263106 TCTTCTCTCAAGGTGATGGAGGG + Intergenic
1119891706 14:78187633-78187655 TCTTCGCTTCTGGTGATGGATGG + Intergenic
1120169571 14:81235557-81235579 CCATGTCTTCACATGATGGAAGG + Intergenic
1122608997 14:102968706-102968728 CTTTGTCTTCAGGTGAAGCAAGG - Exonic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1123796758 15:23780427-23780449 AATTTTCTTCATGTGCTGGAAGG + Intergenic
1123894578 15:24815887-24815909 CCTTTGGCTCAGGTGATGAATGG + Intergenic
1124688199 15:31799933-31799955 ACTTTTCTTCAGGTGAATGGGGG + Intronic
1126860741 15:52880204-52880226 CCTGTTCTTCACGGGATGGATGG + Intergenic
1127303823 15:57682977-57682999 CATTTTGTTCAGGTCATGGCGGG + Intronic
1129391003 15:75220937-75220959 ACTTTCCTTCTGGTGAGGGATGG + Intergenic
1129473305 15:75766940-75766962 ACTTTCCTTCTGGTGAGGGATGG - Intergenic
1129731543 15:77935338-77935360 ACTTTCCTTCTGGTGAGGGATGG - Intergenic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1130186533 15:81688866-81688888 CCCTATCTTCAGGTGCTGGCTGG + Intergenic
1133312825 16:4861388-4861410 CTTTTCCTTCATGTGATAGACGG + Intronic
1133906518 16:10027605-10027627 CCTTGGCTTCTGATGATGGAAGG + Intronic
1134409861 16:13994873-13994895 CCTTTCCTTCTGGTTCTGGAAGG + Intergenic
1143265345 17:5632685-5632707 CCCTTTCAGCAGGTGAAGGACGG + Intergenic
1143304483 17:5935216-5935238 CCTTTCCTTCACGTGAAGGCTGG - Intronic
1143368417 17:6423175-6423197 CCTTTTCTTCAAGGGTGGGAAGG + Intronic
1144215140 17:13048819-13048841 CTTTTTCTTCACGTGATGCATGG - Intergenic
1144385539 17:14746088-14746110 CCTGGTCTTCAGGTGAGAGAGGG - Intergenic
1145884114 17:28371098-28371120 CACTTTTTTCAGGTGATGGGAGG - Intronic
1148403651 17:47390375-47390397 CTTTTTCTTCAAGTGATTTAAGG + Intronic
1149164826 17:53738616-53738638 AATGTTCTTCAGGTGAAGGAGGG - Intergenic
1149354527 17:55826400-55826422 GCGTTTCTTCAGATGAGGGAAGG - Intronic
1153439184 18:5098478-5098500 CCTTATCTTCAGGTGATGCCTGG - Intergenic
1154069564 18:11141204-11141226 TCTTTTCTCCAGTTGATAGAAGG - Intronic
1155486935 18:26354465-26354487 CCTTATCATCAGATGTTGGATGG + Intronic
1157014064 18:43688337-43688359 CTATTTCTTCATGTGGTGGAAGG + Intergenic
1158443639 18:57499994-57500016 CCCTTTCTGGAGGTGATGGATGG - Intergenic
1159677420 18:71303383-71303405 ACTTTTCTTCACCTGCTGGAAGG - Intergenic
1159885962 18:73907099-73907121 CCTTTTCTTGTGATGATGGCAGG + Intergenic
1164788705 19:30958179-30958201 CCTCTTCCTCAGGTGCTGGCTGG - Intergenic
1165269029 19:34688849-34688871 CCTTATCTTCAGGTGCTGGCTGG + Intergenic
1165275453 19:34747169-34747191 TCTTATCTTCAGGTGTTGGCTGG + Intergenic
925095266 2:1193355-1193377 CCTTTTCATCAGGTGGTGAGCGG - Intronic
925290163 2:2742598-2742620 CCCTTTCTTCCTTTGATGGAGGG - Intergenic
926457187 2:13081260-13081282 CCTTTCCTTGAGGTCATGCAAGG - Intergenic
927806179 2:26148823-26148845 CATTTTCTTAGGGTCATGGAGGG + Intergenic
928199623 2:29239384-29239406 GCTGTGCTTCAGGTGAGGGAGGG + Intronic
930048121 2:47191955-47191977 CCTTGTTTTCAGTTGAGGGAAGG + Intergenic
931046275 2:58357513-58357535 CCTTTTGTGCATGTGAAGGAGGG + Intergenic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
933978689 2:87532812-87532834 CCTTTTCTACAGGGGCTGAATGG - Intergenic
934102719 2:88668153-88668175 CCTTTTCTCCAAGTGTAGGATGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
936315143 2:111417983-111418005 CCTTTTCTACAGGGGCTGAATGG + Intergenic
938619008 2:133030269-133030291 CCTGTTCTTAGGGTGATGGATGG + Intronic
940447659 2:153795539-153795561 CCTTTTCTTTAGCTTTTGGAGGG + Intergenic
942564854 2:177256160-177256182 CCTCTTCTTGAGGTGTTTGAGGG - Intronic
943301883 2:186213065-186213087 CCATCTCATCAGGTGATGCAGGG + Intergenic
944351828 2:198737138-198737160 CCTTTAATTCAGGTGATGGCTGG + Intergenic
945340261 2:208644275-208644297 CCTGCTCTTCAGGTGGTGGGTGG + Intronic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
947387030 2:229600749-229600771 CATTTAGTTCAGCTGATGGATGG - Intronic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1171093368 20:22307104-22307126 CCTTTTCTTCATCTGGTTGATGG - Intergenic
1173384399 20:42574546-42574568 CCATTGCTCCAGGGGATGGAGGG + Intronic
1173628862 20:44494678-44494700 CCTCCTCTGCAGGTGAGGGAGGG + Intergenic
1174530816 20:51212189-51212211 CGTTTTCCTCTGGTGGTGGAAGG + Intergenic
1174574015 20:51524251-51524273 AGTTTTCTTCTGGTGAGGGACGG - Intronic
1176954846 21:15090264-15090286 CCTTCTCTTGAGGGGAGGGAGGG - Intergenic
1179246901 21:39641057-39641079 CCTTTTCTTGTGGTGTTGAATGG + Intronic
1179553139 21:42156065-42156087 CCTTTTCTCCAGGGGAAGGCTGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181089794 22:20464811-20464833 CTTTGTCTTCAGGTGATGAGAGG - Intronic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181531031 22:23517570-23517592 CCTTGTCCTCACGTGGTGGAAGG - Intergenic
1184271142 22:43384886-43384908 AATTTTCTTCAGGTGACAGAAGG - Intergenic
1184692586 22:46123952-46123974 CCTTGTCTGGAGGTGATGGGCGG + Intergenic
1184938019 22:47739364-47739386 CATTTTCTCCAGGTGCTGGGAGG - Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949215915 3:1566989-1567011 CCTTTTCAAGAAGTGATGGAAGG - Intergenic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
951911547 3:27755378-27755400 CCTCTTCTACAGGGGATGGAGGG + Intergenic
952823726 3:37507196-37507218 CTCTTTCTTGAGGTGATCGAAGG - Intronic
954818007 3:53299286-53299308 CCTTTTCTGTGGATGATGGAAGG - Intronic
955551546 3:60090478-60090500 CATTTTCTTTACGTGATTGATGG + Intronic
955811604 3:62796454-62796476 CCTTTTCTTGAGCTCATGAATGG + Intronic
955851167 3:63221576-63221598 ACTTTTCTTAAGGTCATAGAAGG - Intergenic
956510728 3:69990120-69990142 CCTCTTATTAAGGAGATGGAAGG - Intergenic
956697542 3:71931261-71931283 CCTTTGTTTCATGTGATAGAGGG + Intergenic
956750576 3:72341054-72341076 CTTTTTCTTCAGCTTCTGGAGGG - Intergenic
957505792 3:81118858-81118880 CTTTTTCTTCACATGATGGCAGG + Intergenic
963214731 3:142732287-142732309 CCCTGTCTTCAGGTGTTGGCTGG + Intronic
963821896 3:149906219-149906241 TCTATTCATCAGTTGATGGATGG + Intronic
964603977 3:158539052-158539074 CCTTTTATCCAGATCATGGAAGG + Intronic
970689575 4:18607009-18607031 CCCTGTCTTCAGGTGTTGGCTGG + Intergenic
970966563 4:21935024-21935046 CCTTTGCTTATGGTGATGGGAGG - Intronic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
972509572 4:39755275-39755297 ACTTTTCTTCATGTGAGGCAGGG - Intronic
972851546 4:43056995-43057017 TCTTTTCCTCAAGTGAAGGAAGG - Intergenic
973541606 4:51941118-51941140 CCTTTTCTGCGGGTGATGCCTGG + Intergenic
974509638 4:62821982-62822004 TCTCTTCTTCAGGTTTTGGATGG + Intergenic
974978400 4:68921601-68921623 GCTTTTTTTCATGTGATGGTTGG - Intergenic
975015839 4:69417707-69417729 TTTTTTCTTCATGTGATGGTTGG + Intronic
975459920 4:74639330-74639352 CTTTTTCTTCAGGTCATATATGG - Intergenic
979946174 4:126833986-126834008 CCTTTTCTTCATGGCAGGGAGGG - Intergenic
981451510 4:144903503-144903525 CCTTGTCTCCTGGTGCTGGAGGG + Intergenic
981817612 4:148849131-148849153 ATTTTTCTTTTGGTGATGGAGGG + Intergenic
983053170 4:163071851-163071873 CCCTATCTTCAGGTGCTGGTTGG - Intergenic
983115126 4:163806017-163806039 CCTGTTCTTCAGAGGATGGTTGG + Intronic
983651063 4:170037232-170037254 CCTTTTCTGTATGTTATGGAGGG + Intergenic
984047629 4:174820771-174820793 CCTTTTCTGTGGGTGGTGGAGGG - Intronic
984793505 4:183635926-183635948 GCTTTCCTTCAGCAGATGGACGG + Intergenic
985037274 4:185853133-185853155 CTTTTTCTTCAAGTTAAGGATGG - Intronic
985185654 4:187312501-187312523 CCTGCTCTTCAGGTGACAGATGG + Intergenic
986085375 5:4439632-4439654 GCTTTACTTCAGGTGATGACAGG + Intergenic
987216241 5:15740314-15740336 CCTTTCCTGCAAGTTATGGATGG + Intronic
988363610 5:30267555-30267577 CCTTTCCTTCACATGGTGGAAGG - Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
990725366 5:58747518-58747540 CCTTTTCTGCAGGTCACAGATGG + Intronic
992531854 5:77659719-77659741 CCTTTTCTCAAGCGGATGGAAGG + Intergenic
993121533 5:83780269-83780291 CCTTTTCTCCAGGTACAGGAAGG + Intergenic
994848307 5:105019984-105020006 CCTTTACTTGAGGTGATAGGAGG + Intergenic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
996106917 5:119516142-119516164 CCATATAATCAGGTGATGGAGGG + Intronic
996178518 5:120389940-120389962 CTGTCTCTTCATGTGATGGAAGG + Intergenic
998409452 5:141898187-141898209 CCTTTTCTTCAGTATAGGGAGGG - Intergenic
998473257 5:142399813-142399835 CCTTTTCTTGTGGAGTTGGATGG + Intergenic
998601250 5:143587341-143587363 CCTTTTCTTCTGGGGGTGGGGGG + Intergenic
999394440 5:151218200-151218222 GCTTGTCTTCAGGTAATGGATGG + Intronic
1000130060 5:158288540-158288562 TCCATTCTTCAGTTGATGGATGG + Intergenic
1000308554 5:160018955-160018977 CCTTGTCTTCAGCTACTGGATGG + Intronic
1000445953 5:161320912-161320934 CATTTCCTTCAGGTTATGAAGGG + Intronic
1000475486 5:161701508-161701530 CCTTTTCTTCAGATGATATTTGG - Exonic
1000686292 5:164253993-164254015 CCTTTTCTTCAGGTTACAAAAGG + Intergenic
1000970034 5:167703942-167703964 CCTCTTCTTCAGGTTAAGAAAGG - Intronic
1001423085 5:171601648-171601670 CATTTTCCTCTTGTGATGGATGG - Intergenic
1001761711 5:174213364-174213386 CTCTTTCTGCAGGTGTTGGATGG + Intronic
1003550655 6:7099574-7099596 CCTTATGTTCATGTGAGGGAGGG + Intergenic
1003628355 6:7764288-7764310 CTTTTTCTGGAGGTGGTGGAAGG + Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005081808 6:21964096-21964118 CCTTTTCTTCTGGGGCTGGGCGG + Intergenic
1006779509 6:36622879-36622901 CCTATTCCCCAGGTGATGGCTGG - Intergenic
1010292556 6:74154993-74155015 CTGTTTCTTCAGGTGAAGAATGG + Intergenic
1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG + Intergenic
1012065321 6:94542831-94542853 CCTTTTCTTTAGTTGATTAAGGG + Intergenic
1015089250 6:129334774-129334796 CTTTGTCTTCACGTGTTGGAAGG + Intronic
1018756734 6:166856321-166856343 CCTTGTCCTCACGTGGTGGAAGG - Intronic
1019399449 7:843955-843977 CCTGTGCTTATGGTGATGGAGGG + Intronic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1019893810 7:3967413-3967435 CCTCTTTTCCAGGTGATGGCGGG - Exonic
1020577206 7:9948093-9948115 TATTTTCTTCAGGTCATGGATGG - Intergenic
1021717884 7:23475427-23475449 CCTTTTCTCCAGATAATGAAAGG - Intergenic
1022037403 7:26547626-26547648 GCCTTTTTTCAGGGGATGGAGGG + Intergenic
1028295516 7:89124990-89125012 CCTTTTCTTCAGGAGAGTGACGG - Intronic
1030804527 7:113898799-113898821 CCTTATCTTCAGGTGTTGGCTGG - Intronic
1032084266 7:128875630-128875652 TTTTTTCTTCTGGAGATGGATGG + Intronic
1032542859 7:132718085-132718107 CCTTTTTCTCAGCTGATGTATGG - Intronic
1033886997 7:145961275-145961297 CCTTGTCCACAGGTGAGGGAGGG + Intergenic
1034116244 7:148586264-148586286 CCTTTTCTCCAGATGAAGGTTGG + Intergenic
1036187232 8:6634002-6634024 CTGTTTCTTCAGGTCATGTATGG - Intronic
1036496870 8:9277696-9277718 CCTTCTCTTCAGAATATGGAGGG + Intergenic
1037501194 8:19486904-19486926 CCTTTTCTTCAAGTGTTGTTGGG - Intronic
1038479412 8:27891614-27891636 CCCTGTCTTCAGGTGTTGGCTGG - Intronic
1039891808 8:41690589-41690611 CCTCTCCTGCAGGTGTTGGAAGG - Exonic
1041342992 8:56865792-56865814 CCATTTGTTCAGGTGATTGTAGG - Intergenic
1042642437 8:70951206-70951228 GCTTTTCTTCATGTGTTGGCAGG - Intergenic
1043862547 8:85337054-85337076 CCTTTTCTTCCAGTGCTGAAAGG - Exonic
1044738803 8:95304769-95304791 CCTTCTCTTCAGGATTTGGAAGG - Intergenic
1046066073 8:109197898-109197920 AATTATTTTCAGGTGATGGACGG - Intergenic
1047738192 8:127784842-127784864 CCCTATCTTCAGGTGTTGGCTGG + Intergenic
1050034885 9:1424635-1424657 CCTTTCCTAGGGGTGATGGACGG - Intergenic
1050302670 9:4275282-4275304 CCATTTCTTCAGCTCATGGATGG + Intronic
1051883028 9:21859409-21859431 ACTTACCTTCAGGTTATGGAGGG - Exonic
1052576899 9:30302473-30302495 GCTTTTCTTCATGTGATTGTTGG - Intergenic
1055585328 9:77753305-77753327 CTTTTTCTTCAGGGGGTGGGTGG - Intronic
1056708475 9:88971216-88971238 CCGTTTCTTCTAGTAATGGAGGG - Intergenic
1058938510 9:109791568-109791590 GCTTTTCTTAAGGGGTTGGAGGG + Intronic
1186735380 X:12457969-12457991 CCTTATCATTAAGTGATGGAGGG - Intronic
1187833698 X:23409045-23409067 CCTCTTCTTCAGGTCACAGATGG - Intergenic
1188600052 X:31952633-31952655 GCTTTTCTTCAGTTGTTTGAAGG + Intronic
1190783854 X:53624666-53624688 ACTTTTCTTTTAGTGATGGATGG - Exonic
1192390064 X:70716680-70716702 CCTTTCCTAGGGGTGATGGATGG - Intronic
1193154549 X:78158639-78158661 CCTTTTCTTCGGCGGATGGGAGG + Intergenic
1194031879 X:88827667-88827689 CCTTTTCTTGAGATGATGCTAGG + Intergenic
1194576979 X:95625256-95625278 TCCTTTCTTCATGTGAAGGAAGG - Intergenic
1194605650 X:95975006-95975028 CCTTTTCTTCTGGAGTTGGGAGG + Intergenic
1195050752 X:101094601-101094623 CATTTTCTTCAGCAGAGGGAGGG - Exonic
1195574585 X:106435770-106435792 CCTTTTCTACAGGTTATGGTGGG - Intergenic
1198167393 X:134071114-134071136 CCTTTTCCTGAGTTGGTGGATGG + Intergenic
1199500853 X:148504277-148504299 CCTTTTCTTCATTGGAAGGAAGG + Intronic
1199535450 X:148897659-148897681 CCATTTCTTCTGGTTATGAATGG + Intronic
1199746886 X:150777472-150777494 TCTTTTCTTCAGGTGATGGCCGG - Exonic
1200324839 X:155225506-155225528 CTTTCTCTTCAGGTGAAGCAGGG + Intronic
1200925334 Y:8649249-8649271 GCCTTTTTTCAGGTGAAGGAGGG + Intergenic