ID: 996063356

View in Genome Browser
Species Human (GRCh38)
Location 5:119055664-119055686
Sequence CACTGTTACAGCATCATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996063356 Original CRISPR CACTGTTACAGCATCATGCA GGG (reversed) Intronic
900597313 1:3487266-3487288 GACTGTTCCAGCAACATGGATGG + Intergenic
901279733 1:8025265-8025287 CACTAATACAGCACCATTCACGG + Intronic
902211516 1:14908000-14908022 CTCTGTGCCAGCATCATGCCGGG + Intronic
905411339 1:37770945-37770967 CATTATTACAACATCATGAAGGG + Intergenic
906174622 1:43760435-43760457 GGATGTTACAGAATCATGCATGG + Intronic
909396113 1:75172700-75172722 GACTGTTCCAGCATTCTGCAAGG - Intergenic
918520062 1:185405746-185405768 CACTGCTACAGTAGCATGAAAGG + Intergenic
920507731 1:206528459-206528481 CACCATTATAGCATCAGGCAGGG - Intronic
920835142 1:209503618-209503640 TTCTGTTACAAAATCATGCATGG - Intergenic
923276713 1:232403106-232403128 TACTGCAACAGCACCATGCAGGG - Intronic
923993194 1:239462530-239462552 CACTTTTACAGCTGCCTGCAGGG + Intronic
1064128496 10:12686284-12686306 TACTACTACAACATCATGCATGG - Intronic
1067096430 10:43304322-43304344 CAGTGTTAAAGCATCAGGTAGGG + Intergenic
1069162735 10:65110791-65110813 CACTGTAACAGCCTCAGGAATGG + Intergenic
1073013521 10:100380460-100380482 TAATGTTACAAAATCATGCATGG + Intergenic
1073761399 10:106632378-106632400 CACTGTAACAGCTTCACGCTGGG + Intronic
1074579060 10:114699243-114699265 CATTATTAAAGCATCATCCAAGG - Intergenic
1077432206 11:2521414-2521436 CAGTCTGAAAGCATCATGCATGG - Intronic
1077494455 11:2880052-2880074 CACCATTACAGTATCATACAAGG - Intergenic
1078757590 11:14225601-14225623 TATTGTTACAGCTTCAGGCATGG + Intronic
1078839623 11:15066364-15066386 CACTGTAACAGCCTCAGGAATGG + Intronic
1078957805 11:16221832-16221854 CAATGTTACAAAATCATGCATGG + Intronic
1079698691 11:23517529-23517551 CCCAGTGACAGCATGATGCAGGG - Intergenic
1080797321 11:35576913-35576935 CGATGTTACAAAATCATGCATGG + Intergenic
1082296185 11:50443615-50443637 CACTGTAACAGCCTCAGGAATGG - Intergenic
1084019751 11:66410411-66410433 CTCTGTTAAAGCACCATTCAAGG - Intergenic
1084432708 11:69120394-69120416 CACGCTCACAGCAGCATGCAGGG + Intergenic
1085272588 11:75278977-75278999 CCCTGTTTCAGCATCCTGCTGGG - Intronic
1085712935 11:78846543-78846565 CCCCGTTAAAGCATCATGCAAGG + Intronic
1091953331 12:4613992-4614014 CAGTGTTACAGCATCATTAATGG + Exonic
1097671762 12:62548166-62548188 CACTGTGACAGCAGCATGGAAGG + Intronic
1097869129 12:64585572-64585594 CACTGTTACTGCATTTTGCTAGG + Intergenic
1098364151 12:69684846-69684868 CATTGCAACAACATCATGCAGGG + Intronic
1098788889 12:74795059-74795081 TGCTGTTACAGAATCATTCAGGG + Intergenic
1099555530 12:84104645-84104667 CACTGTAACAGCCTCAGGAATGG + Intergenic
1100668028 12:96776787-96776809 CAATGTTACAAAATCATGCATGG - Intronic
1101305429 12:103522937-103522959 CATTGTTACAGGATTATGGAAGG + Intergenic
1101671561 12:106879832-106879854 CACTGTGACAGTATCATGGCGGG - Intronic
1109794589 13:67293565-67293587 CACTAATACATCATCATGAAGGG + Intergenic
1111032168 13:82616572-82616594 CACTGCTAAGGCATCAAGCATGG - Intergenic
1111088406 13:83407748-83407770 CAATGTGCCAGCATCTTGCAAGG - Intergenic
1111275921 13:85946689-85946711 AAGTGTTACAGCAGCTTGCATGG + Intergenic
1115235020 14:31200851-31200873 TACTGTGACAGCATGAAGCAGGG - Intronic
1115708999 14:36029314-36029336 CACTATTAAGGCACCATGCATGG - Intergenic
1117100032 14:52336040-52336062 CACTGTTACAGAAAAATGAAGGG + Intergenic
1117432993 14:55688241-55688263 CAGTGTTACAAAGTCATGCATGG + Intronic
1118929249 14:70224997-70225019 CATTATTACAGCATCATTTATGG + Intergenic
1124008272 15:25811730-25811752 CACTGATAAACCACCATGCATGG - Intronic
1128639670 15:69326973-69326995 CACCATTACAGTATCATGCTGGG + Intronic
1131024863 15:89131758-89131780 CACTGTTACAGCAACACTTATGG - Intronic
1131394495 15:92075823-92075845 CTGTGTCTCAGCATCATGCATGG + Intronic
1135723160 16:24834073-24834095 CACTGTCACAGAACCATGCATGG - Intergenic
1141214229 16:82009188-82009210 CACTGCTAGAGCAGCATGGAAGG + Intronic
1144179565 17:12739309-12739331 TACCTTTACAGCAGCATGCACGG - Exonic
1144748621 17:17633208-17633230 CACTGTGATAGCAACATGCCAGG + Intergenic
1149067311 17:52495958-52495980 GCCTGTGACAGCATCTTGCAGGG + Intergenic
1152968690 18:140758-140780 CACTGTTACAGTATCATAAACGG - Intergenic
1153424171 18:4944716-4944738 CCCTGTGACAGCTTCATCCAAGG - Intergenic
1156786671 18:40923528-40923550 CACTGCTATAGCCTCATCCAGGG + Intergenic
1158410729 18:57203609-57203631 CAGTGTTAAAGCATCAGGAATGG - Intergenic
1160078986 18:75704658-75704680 GACTCTTTAAGCATCATGCAAGG - Intergenic
1163942053 19:20504306-20504328 CACTGTAACAGCCTCAGGAATGG + Intergenic
927640921 2:24844783-24844805 CACTATTACTGCTTCAGGCAGGG - Intronic
929054731 2:37866183-37866205 TCCTTTTCCAGCATCATGCATGG - Intergenic
930442882 2:51431406-51431428 CACAGTTACGGCAGAATGCAAGG - Intergenic
931600018 2:63993792-63993814 CACTGTAACAGCCTCAGGAATGG - Intronic
932400497 2:71477658-71477680 AACTGTTACAGAATCATACGTGG + Intronic
936724282 2:115293777-115293799 AATTTTTACAGGATCATGCAGGG - Intronic
936946159 2:117932750-117932772 CACTGTGACAGGATCATGAGTGG - Intronic
937670648 2:124534018-124534040 CACTTTTGCAGCAACATGAATGG + Intronic
943184104 2:184583728-184583750 CACCATTATAGTATCATGCAGGG - Intergenic
945107930 2:206333896-206333918 TAATGTTACAAAATCATGCATGG - Intergenic
948731733 2:239968499-239968521 CCCTGTTACTGCCTCATGAAAGG - Intronic
1173958764 20:47055231-47055253 CACTGATACAGTCCCATGCAGGG - Intronic
1177014884 21:15774238-15774260 CAGTGTTACAAACTCATGCATGG - Intronic
1177305843 21:19315274-19315296 CACTGTTTCAGCATGATCCTGGG - Intergenic
1181872038 22:25907302-25907324 CACAGTTCCAACATTATGCACGG + Intronic
1184391053 22:44203828-44203850 CAATGTTGCAGCATGCTGCAGGG - Intronic
949899986 3:8804722-8804744 CACTATTACAGTATCATTGAGGG - Intronic
950883889 3:16346244-16346266 CACTGTGAGAGCATGATGAATGG - Intronic
952390567 3:32875935-32875957 GATTGTTTCAGTATCATGCATGG - Intronic
956304147 3:67805544-67805566 CACTTTCACAGCCCCATGCAGGG + Intergenic
956394158 3:68806906-68806928 TTCTGTTACAGCATCCTGAAAGG + Intronic
957353794 3:79057130-79057152 CACTGTAACAGCCTCAGGAATGG - Intronic
959021821 3:101195692-101195714 TACTGATACAGCATCGAGCAGGG + Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963479781 3:145856873-145856895 CTCTTTCATAGCATCATGCATGG + Intergenic
964228228 3:154431994-154432016 CAAGGTTCCAGCATCTTGCAAGG + Intergenic
964532297 3:157681717-157681739 CACTGATAGACCATCATCCAAGG - Intergenic
970765322 4:19541446-19541468 CACTATTAAAACATAATGCATGG + Intergenic
972595006 4:40522082-40522104 TGATGTTACAGAATCATGCATGG + Intronic
972758818 4:42080845-42080867 TAATGTTATAGAATCATGCATGG - Intronic
972967893 4:44534876-44534898 CAGTGTTTCAGCACTATGCATGG - Intergenic
977417780 4:96756757-96756779 CTCTGTTTCAGCCTCTTGCATGG + Intergenic
977846799 4:101776544-101776566 CACCATTACAAAATCATGCAAGG + Intronic
979178771 4:117699327-117699349 CACTAATGCAGCATCAAGCACGG - Intergenic
980416690 4:132497846-132497868 ACCTTTTACAGCATCATGCCAGG + Intergenic
985007109 4:185544889-185544911 CACAGTGGCAGCAGCATGCAGGG - Intergenic
985787199 5:1902950-1902972 CACATTTAGAGCACCATGCAAGG + Intergenic
986453853 5:7895046-7895068 TACAGTTACACCACCATGCAAGG + Intronic
989023559 5:37040174-37040196 CACTGGTTCAAAATCATGCAAGG - Intronic
989292093 5:39780058-39780080 AACTGCTACAGCTTCATGTAAGG + Intergenic
991241133 5:64461153-64461175 CATTGTTACATCATCTTGCTGGG - Intergenic
992247118 5:74837287-74837309 CAATTTTACAGCTTTATGCAGGG + Intronic
993303987 5:86252144-86252166 CGCTGGTCCAGCATCATGCTTGG - Intergenic
994447181 5:99891265-99891287 GACTGTTACAGATTCCTGCAGGG - Intergenic
995871325 5:116746549-116746571 CACTGTTATTGCATCCTTCAAGG + Intergenic
996063356 5:119055664-119055686 CACTGTTACAGCATCATGCAGGG - Intronic
998370845 5:141660166-141660188 CTCTGTTGCTGCATCATGAAAGG + Intronic
998641576 5:144017662-144017684 CAATATAACAGCATGATGCAGGG - Intergenic
1008036504 6:46750918-46750940 GAATGTTACAAAATCATGCATGG - Intronic
1009523411 6:64713370-64713392 CACGCTGACAGCATCATGAAAGG - Intronic
1012038490 6:94173375-94173397 GACTTTTACAGCAACATGAATGG + Intergenic
1014194915 6:118544190-118544212 CAATGTAACAGCATCATGATCGG + Intronic
1014960839 6:127682415-127682437 CACTGTTAGGGCATTATCCATGG + Intergenic
1017578948 6:155839175-155839197 TATTGCTACAGCATCATGAATGG + Intergenic
1017619937 6:156286265-156286287 CACAGTTCCACCATCATTCATGG + Intergenic
1018425288 6:163674296-163674318 CACTGTCACAGCACTGTGCAAGG - Intergenic
1020360967 7:7326210-7326232 AATTCTTACAGCATTATGCATGG + Intergenic
1023526529 7:41109362-41109384 CAGTGTTATAGCATAAGGCAGGG - Intergenic
1024968627 7:55048481-55048503 CACTTTGAAAGCATCATGGAAGG - Intronic
1027717373 7:81689688-81689710 CCCTCTTATAGCATCATGCCTGG - Intergenic
1035085610 7:156254962-156254984 CTCTGTTACCGCAGCCTGCATGG + Intergenic
1035522386 8:285242-285264 CACCATGACAGCACCATGCAGGG + Intergenic
1036414376 8:8533434-8533456 TAAGGTTACAGAATCATGCATGG - Intergenic
1038694319 8:29792561-29792583 CACCGTTATAGTATCATACAGGG - Intergenic
1040029345 8:42810239-42810261 CAATTTTACAGCATCAATCATGG + Intergenic
1041040902 8:53844864-53844886 CACTGTTACAGGAGCCTGAATGG - Intergenic
1043494369 8:80783819-80783841 CACCATTATAGCATCATACAAGG + Intronic
1045328811 8:101137613-101137635 CACTGCTGCAGCACCATGGAGGG - Intergenic
1045826668 8:106405690-106405712 CTCTGTTACATCATCATGGCTGG - Intronic
1047159551 8:122362545-122362567 TACTGTTAGAGCAGCATGAAAGG - Intergenic
1048274708 8:133057530-133057552 CACAGCGACAGCATGATGCAGGG - Intronic
1048688859 8:136935816-136935838 CTCTGCTACAGAACCATGCATGG + Intergenic
1049098114 8:140560690-140560712 CACTGTGACAGCAGCAGGCTGGG + Intronic
1049985138 9:943382-943404 CCCTGTGACAGCAACCTGCATGG - Intronic
1050105913 9:2166574-2166596 TAGAGGTACAGCATCATGCAAGG - Intronic
1050389011 9:5117243-5117265 CTCTGTTATAGCAGCATACATGG + Intronic
1057171936 9:92968200-92968222 CACAGTCACAGCGTCATGCCAGG + Intronic
1058149392 9:101447283-101447305 CACAGTTATTGCTTCATGCATGG + Intergenic
1059138371 9:111829197-111829219 CACTAGTCAAGCATCATGCACGG + Intergenic
1188777143 X:34233878-34233900 CATTGTTACAATATAATGCAAGG - Intergenic
1190267216 X:48834490-48834512 CACTGCCACAGCCACATGCAAGG + Intronic
1190436113 X:50427408-50427430 CACCATTACAGTATCATACAGGG - Intronic
1190923259 X:54877622-54877644 CACCATTAAAGAATCATGCATGG - Intergenic
1191029880 X:55958360-55958382 CACTGTTGCAGCATCAACCAAGG + Intergenic
1191975197 X:66863896-66863918 CACTGTTCCAGAATGAGGCATGG + Intergenic
1192964823 X:76166126-76166148 CAGTGTTCAAGGATCATGCAGGG + Intergenic
1194318824 X:92417078-92417100 GCATGTTACAGCATCATTCAGGG - Intronic
1196706175 X:118719182-118719204 CACTATTATAGCATTATGCCTGG + Intergenic
1196912378 X:120497246-120497268 CATTATTACAGAATCCTGCAAGG + Intergenic
1200626956 Y:5530234-5530256 GCATGTTACAGCATCATTCAGGG - Intronic
1201054748 Y:9977472-9977494 CAGTGTTAAAGGATTATGCATGG - Intergenic
1201985768 Y:19963154-19963176 CAGTGTTAAAGCATCAGGTATGG - Intergenic
1202191640 Y:22251976-22251998 CAGTGTTAAAGGATTATGCATGG + Intergenic