ID: 996066096

View in Genome Browser
Species Human (GRCh38)
Location 5:119080948-119080970
Sequence CTAACTCATCCCTAAAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996066090_996066096 8 Left 996066090 5:119080917-119080939 CCCTCCCTAGGCAAAAAAGATGT 0: 1
1: 0
2: 2
3: 14
4: 170
Right 996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG No data
996066092_996066096 4 Left 996066092 5:119080921-119080943 CCCTAGGCAAAAAAGATGTAAAT 0: 1
1: 0
2: 1
3: 40
4: 443
Right 996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG No data
996066089_996066096 9 Left 996066089 5:119080916-119080938 CCCCTCCCTAGGCAAAAAAGATG 0: 1
1: 0
2: 2
3: 25
4: 167
Right 996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG No data
996066093_996066096 3 Left 996066093 5:119080922-119080944 CCTAGGCAAAAAAGATGTAAATC 0: 1
1: 0
2: 3
3: 19
4: 312
Right 996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG No data
996066091_996066096 7 Left 996066091 5:119080918-119080940 CCTCCCTAGGCAAAAAAGATGTA 0: 1
1: 1
2: 0
3: 8
4: 141
Right 996066096 5:119080948-119080970 CTAACTCATCCCTAAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996066096 Original CRISPR CTAACTCATCCCTAAAGGCT TGG Intronic
No off target data available for this crispr