ID: 996066287

View in Genome Browser
Species Human (GRCh38)
Location 5:119083169-119083191
Sequence GTGTATATACAAAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20329
Summary {0: 1, 1: 3, 2: 24, 3: 1089, 4: 19212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996066287_996066289 4 Left 996066287 5:119083169-119083191 CCTGGCTAATTTTGTATATACAC 0: 1
1: 3
2: 24
3: 1089
4: 19212
Right 996066289 5:119083196-119083218 ATATATTTTTTAGTAGAGATGGG 0: 29
1: 339
2: 5048
3: 18264
4: 36648
996066287_996066288 3 Left 996066287 5:119083169-119083191 CCTGGCTAATTTTGTATATACAC 0: 1
1: 3
2: 24
3: 1089
4: 19212
Right 996066288 5:119083195-119083217 TATATATTTTTTAGTAGAGATGG 0: 64
1: 580
2: 10524
3: 15076
4: 34627
996066287_996066291 27 Left 996066287 5:119083169-119083191 CCTGGCTAATTTTGTATATACAC 0: 1
1: 3
2: 24
3: 1089
4: 19212
Right 996066291 5:119083219-119083241 TTTCGCCATGTTGACCAGGCTGG 0: 635
1: 20819
2: 150237
3: 212256
4: 199497
996066287_996066290 23 Left 996066287 5:119083169-119083191 CCTGGCTAATTTTGTATATACAC 0: 1
1: 3
2: 24
3: 1089
4: 19212
Right 996066290 5:119083215-119083237 TGGGTTTCGCCATGTTGACCAGG 0: 27
1: 1113
2: 23942
3: 161301
4: 231450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996066287 Original CRISPR GTGTATATACAAAATTAGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr