ID: 996070462

View in Genome Browser
Species Human (GRCh38)
Location 5:119125435-119125457
Sequence ATTTTAGCAGGGCCACTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996070459_996070462 0 Left 996070459 5:119125412-119125434 CCATAAGAAAGGTGCTATATTCT 0: 1
1: 0
2: 3
3: 18
4: 223
Right 996070462 5:119125435-119125457 ATTTTAGCAGGGCCACTATATGG No data
996070457_996070462 15 Left 996070457 5:119125397-119125419 CCTTGTTGGTTACTACCATAAGA 0: 1
1: 0
2: 3
3: 9
4: 88
Right 996070462 5:119125435-119125457 ATTTTAGCAGGGCCACTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996070462 Original CRISPR ATTTTAGCAGGGCCACTATA TGG Intronic
No off target data available for this crispr