ID: 996072570

View in Genome Browser
Species Human (GRCh38)
Location 5:119150274-119150296
Sequence GAAAGAACCTGAGCATGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996072570_996072575 21 Left 996072570 5:119150274-119150296 CCTGAGCATGCTCAGGTTCTTTC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 996072575 5:119150318-119150340 TTTACCAGGACTCAGCCGGATGG 0: 1
1: 0
2: 0
3: 4
4: 83
996072570_996072574 17 Left 996072570 5:119150274-119150296 CCTGAGCATGCTCAGGTTCTTTC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG 0: 1
1: 0
2: 1
3: 4
4: 73
996072570_996072573 7 Left 996072570 5:119150274-119150296 CCTGAGCATGCTCAGGTTCTTTC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 996072573 5:119150304-119150326 TTACTTCATTCTAGTTTACCAGG 0: 1
1: 0
2: 0
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996072570 Original CRISPR GAAAGAACCTGAGCATGCTC AGG (reversed) Exonic
900710888 1:4113038-4113060 GACAGAACCTACCCATGCTCTGG - Intergenic
901789463 1:11646774-11646796 GAAAGGACCGGAGCCTGCACTGG - Intergenic
902970172 1:20042696-20042718 GAAAGTACCTGACCATGCCTAGG + Intronic
903318309 1:22526171-22526193 GAAAGACCGTGAGGCTGCTCTGG - Intronic
903365500 1:22803092-22803114 GAAATAGCCTGAGGAGGCTCTGG + Intronic
903759157 1:25685667-25685689 GGAAGAACTTGTGCATACTCTGG + Intronic
907818039 1:57939196-57939218 GAAAGAAAGAGAGCATGCTCTGG + Intronic
908011381 1:59780936-59780958 GAAAAAACCAGAGCAACCTCAGG - Intergenic
908044706 1:60156058-60156080 GAAAGGACCTCAGCATTCTGGGG - Intergenic
908336714 1:63133047-63133069 AAAAGAACCTGATAAAGCTCAGG - Intergenic
908588269 1:65598227-65598249 TTAAGAACCTGAGCCTGGTCAGG - Intronic
908757911 1:67485968-67485990 GAAATAAACTAACCATGCTCTGG + Intergenic
910391868 1:86754128-86754150 GTAAGCACGTGAACATGCTCAGG + Intergenic
913424672 1:118713872-118713894 AGCAGATCCTGAGCATGCTCTGG - Intergenic
914938928 1:152004790-152004812 AAGAGAAACTGAGCATGCTCAGG - Intergenic
916870403 1:168907896-168907918 GGAAGAAGCTGACCAGGCTCAGG + Intergenic
919096565 1:193044007-193044029 TATAGAACCTGAGGATGATCTGG + Intronic
1066577507 10:36842698-36842720 CAAAGAACCTAGGCATGCCCTGG - Intergenic
1069589644 10:69633950-69633972 GAAAGAGGCTGAGCAGCCTCTGG - Intergenic
1070508783 10:77140714-77140736 GCAAGAACCCCGGCATGCTCTGG + Intronic
1070603218 10:77880056-77880078 GAATGAACCTGAGCATGCAGGGG + Intronic
1076303609 10:129447405-129447427 GAAAAAATTAGAGCATGCTCAGG + Intergenic
1079905373 11:26239672-26239694 GACAGAAGCTGGGCATGCTAAGG - Intergenic
1080842675 11:35999288-35999310 GAAGGAACCTCTGCATCCTCAGG - Intronic
1084144708 11:67258792-67258814 GAAAGTAGCTGAGCAGGGTCTGG + Intergenic
1084653697 11:70503234-70503256 GTAAGCACCTAAGGATGCTCAGG - Intronic
1089132086 11:116220160-116220182 GAAAAGACCTGTGCATCCTCTGG - Intergenic
1090915689 11:131160287-131160309 GAAAGCACCTGAGGATGGCCTGG - Intergenic
1091492019 12:940881-940903 GAAAGAACCTCAGGATCCTGTGG + Intronic
1092083235 12:5735334-5735356 GGAAGAACCCAAGCCTGCTCAGG + Intronic
1093459262 12:19393650-19393672 GAAAGAAAATGAGGAGGCTCAGG + Intergenic
1097958414 12:65509824-65509846 GAATGAACCTGGGCAGACTCAGG - Intergenic
1098389369 12:69952899-69952921 GAAACAACCAGGGCATGCTGGGG - Intronic
1100434403 12:94558810-94558832 GAAAGAGCAAGGGCATGCTCTGG + Intergenic
1103010530 12:117455191-117455213 GTAGGAACCAGAGCATGCTGGGG + Exonic
1103075522 12:117979330-117979352 GAAAGATTCTGAGAAGGCTCTGG + Intergenic
1104545826 12:129712008-129712030 GAAATAACCTGAGGATGTACTGG - Intronic
1104795004 12:131511176-131511198 GAAAGAAGCAGAGAATGTTCGGG - Intergenic
1105935722 13:25096384-25096406 GAAGGACGCGGAGCATGCTCTGG + Exonic
1114929149 14:27445732-27445754 GGAAGCACATAAGCATGCTCAGG + Intergenic
1116114873 14:40635366-40635388 GAAAGAACCTGTGCATTTTGGGG + Intergenic
1119601642 14:75980738-75980760 GACAGATCTTGAGCAAGCTCAGG - Exonic
1121558725 14:94858338-94858360 GAAATAGCCTGAGCATGCAGGGG - Intergenic
1121931789 14:97978834-97978856 GGAAGAAGCTGAGCATGTTGCGG - Intergenic
1122054023 14:99080132-99080154 GAGAGAAGCTGACCATGTTCTGG - Intergenic
1125210086 15:37204362-37204384 GTGAGCACCTGAGCATGCTGTGG + Intergenic
1125338571 15:38652366-38652388 GGTAGAACCCTAGCATGCTCTGG + Intergenic
1125919388 15:43516536-43516558 GTAAGAGCATGAGCATCCTCGGG + Intronic
1128240787 15:66099788-66099810 AAATGAGCCTGAGCATGCTCAGG - Intronic
1128920985 15:71609935-71609957 GAAAGAAAGTGAACTTGCTCGGG + Intronic
1129627325 15:77215424-77215446 TAAAGGACTTGAGCATCCTCAGG - Intronic
1129755673 15:78097689-78097711 GGAAGTACCTAAGCCTGCTCTGG - Intronic
1130154235 15:81335886-81335908 GACAGAACCTAAGGAGGCTCAGG + Intronic
1137860352 16:51840588-51840610 GAAAGAAACAGAGAATGCTGTGG + Intergenic
1139102304 16:63783651-63783673 GAATGAGCTTGAGCATGATCTGG + Intergenic
1141470817 16:84237212-84237234 GACAGAGCCTGAGTTTGCTCAGG + Exonic
1148052108 17:44774538-44774560 GACAGAACCTGGGCATGATGTGG + Exonic
1148990924 17:51666590-51666612 CCAAGAACCTGGGCAGGCTCTGG - Intronic
1149004747 17:51793885-51793907 TCCAGAATCTGAGCATGCTCAGG - Intronic
1150499619 17:65637944-65637966 GAAAGAGCCTGAGCTTTGTCTGG + Intronic
1152216212 17:79034154-79034176 GAAAGAACCTGGGAATTCTATGG - Intronic
1152271568 17:79328027-79328049 GACAAAACCTGACCTTGCTCTGG + Intronic
1156611751 18:38733171-38733193 GAGACAACCTGAGGCTGCTCTGG - Intergenic
1157058513 18:44258354-44258376 GAAAGAAAATGAGCAAGCACAGG + Intergenic
1160020937 18:75180718-75180740 GGAAGAACCAGACCAGGCTCAGG - Intergenic
1160828908 19:1093708-1093730 GAAAGAAGCTGAGCATGAGAGGG + Intronic
1168164469 19:54537297-54537319 AAAAGAAGCTGAGCATGATGGGG + Intronic
933039537 2:77445610-77445632 GAAATAAGCTTAACATGCTCAGG + Intronic
933775925 2:85771106-85771128 GAAAGAACCACAGCGTTCTCTGG - Intronic
937116256 2:119407053-119407075 GAAAGCACCTGTCCCTGCTCAGG + Intergenic
937201497 2:120207059-120207081 GTAAGAATCTGAGGCTGCTCAGG + Intergenic
937914597 2:127092703-127092725 GAAGGAACCTGGGCACACTCTGG - Intronic
938912368 2:135897766-135897788 CAACGAACCTGAGAGTGCTCAGG + Intergenic
1169546257 20:6654105-6654127 CAGAGAACCTCAGCATACTCTGG + Intergenic
1171965331 20:31525522-31525544 GAAAGAACTTCAGCATGAGCAGG + Intronic
1173615038 20:44397233-44397255 GAAAGCACCTAAGCATTGTCAGG + Intronic
1173618575 20:44419078-44419100 GAAAGAACATCAGAATGCACAGG - Intronic
1175229574 20:57465267-57465289 CAAAGGACCTGCGCATGGTCTGG - Intergenic
1177894285 21:26842891-26842913 GAAAGATCCTGACCATGCAAAGG - Intronic
1178353392 21:31889824-31889846 GAAAGTACCTGAGAATGTGCGGG + Intronic
1178424557 21:32469009-32469031 GAAAGAGCCTGTGCATGGTGTGG - Intronic
1178916843 21:36709526-36709548 GAAAGCACTTGACCACGCTCGGG - Intronic
1179491794 21:41745791-41745813 GAAAGAAACTGCTCATGATCTGG - Exonic
1184072935 22:42157259-42157281 TAAGGAACCTGAGCATCCTTGGG - Intergenic
1184309424 22:43631590-43631612 GAAGGAACTGGAGCATCCTCTGG - Intronic
951078102 3:18421909-18421931 GAAATAACCTCAGCATGCAATGG + Intronic
951534221 3:23726786-23726808 GAAAAAACCTGAGCAAGCCATGG - Intergenic
952561537 3:34599510-34599532 GCAGGGACATGAGCATGCTCTGG - Intergenic
952858236 3:37791006-37791028 GAAAGAAAATGAGTAGGCTCCGG + Intronic
953409687 3:42683644-42683666 CACAGCACCTGAGCAAGCTCTGG - Intergenic
956647798 3:71473934-71473956 GAAAGATACTGAACATGCCCTGG + Intronic
959434376 3:106296252-106296274 GAAACAACCAGAGAAAGCTCAGG + Intergenic
960958876 3:123055091-123055113 GAGAGAAGATGAGCAGGCTCTGG + Intergenic
963951216 3:151204048-151204070 GAAAGAAGCCTAGCATGCTGGGG + Intronic
964021895 3:152022580-152022602 GCAAGAACCAGAGCATGATGGGG + Intergenic
964983815 3:162715923-162715945 GAAAGTACCTAAGCATGCCTAGG - Intergenic
968210351 3:196843564-196843586 GAAACAACCTAAGCATGTCCGGG - Intergenic
968269757 3:197394428-197394450 GAAGGAACCTGAGCATGCCACGG + Intergenic
969107156 4:4816141-4816163 GAAAGACCCTGCCCATGCTCAGG + Intergenic
974134157 4:57793256-57793278 GAAAGTACCTGTGCGTGATCAGG + Intergenic
976947850 4:90792492-90792514 GAAAGAAGCTGAGCCATCTCTGG - Intronic
977176759 4:93828541-93828563 AAAAAAACCTGAGCAGGCTTGGG + Intergenic
977360421 4:95997442-95997464 GAAAGGAGCAGAGCAAGCTCTGG + Intergenic
986998024 5:13629503-13629525 GAGAGTACCTTAGTATGCTCAGG + Intergenic
989759263 5:44992689-44992711 GAAAGAGTCTTGGCATGCTCTGG - Intergenic
993105254 5:83592945-83592967 GACAGAACCAGAGGCTGCTCTGG + Intergenic
993539015 5:89125003-89125025 GAAAGGAACAGAGCATGCTTAGG - Intergenic
994335954 5:98566708-98566730 GAAAGAAACTGAAGATGCTCAGG + Intergenic
994498701 5:100546261-100546283 GAAAGCTCCTGTGCATTCTCTGG - Intronic
996072570 5:119150274-119150296 GAAAGAACCTGAGCATGCTCAGG - Exonic
996266219 5:121543925-121543947 GAAAGAACCTGATGAAGCTCGGG + Intergenic
998338513 5:141395216-141395238 GAATGAAGCTGATCATGGTCAGG + Exonic
1000372715 5:160552565-160552587 GAAGGCACCTGAGAATGCTTTGG + Intergenic
1002699709 5:181114264-181114286 GAGAGAATCTTGGCATGCTCAGG + Intergenic
1003306017 6:4930259-4930281 GAACCAATCTGAGCATGCACAGG - Intronic
1003804599 6:9713057-9713079 CAAGGAAACTGAGCATCCTCTGG + Intronic
1003807292 6:9739386-9739408 GAAAGAACCTAAGCATTAACAGG + Intronic
1004544256 6:16582122-16582144 GAAAGAACCAGAGAATAGTCAGG - Intronic
1006300207 6:33190112-33190134 GAACAACCCTGAGCATGCTGAGG + Intronic
1007114326 6:39332761-39332783 GAAAGAGAGAGAGCATGCTCTGG - Exonic
1011000269 6:82580880-82580902 GAAAGAATATGTGCATGCCCTGG + Intergenic
1011381924 6:86751201-86751223 GAAAGAACTTGAGGACGCTGAGG + Intergenic
1011591227 6:88972460-88972482 GAAAGAAGCTGAGCAGCCTCTGG - Intergenic
1012282627 6:97346979-97347001 GAACGATCCTTAACATGCTCAGG + Intergenic
1012954565 6:105554858-105554880 GCAGGCACATGAGCATGCTCAGG + Intergenic
1013596314 6:111663858-111663880 GGAGGAACTGGAGCATGCTCGGG + Intronic
1015764551 6:136702092-136702114 GAAAATACCTAAGCATGCTAAGG + Intronic
1016075260 6:139788371-139788393 GAATGCACCTGCGCCTGCTCAGG + Intergenic
1017300210 6:152848618-152848640 CAAAGAACTTGAGCAGGATCAGG + Intergenic
1017574259 6:155784033-155784055 GAAAGAACTTGATCATGTTTGGG + Intergenic
1018042051 6:159933519-159933541 GCAAGCACCTGACCATGCTAAGG - Intergenic
1021622521 7:22562685-22562707 GAAAAAAAGTGAGCATGCTATGG - Intronic
1023167034 7:37353202-37353224 AAAAGGACCTTAGCAGGCTCAGG - Intronic
1025201613 7:56965609-56965631 TAAAGAACGTAAGCATCCTCCGG + Intergenic
1025670331 7:63611321-63611343 TAAAGAACGTAAGCATCCTCCGG - Intergenic
1027643106 7:80762431-80762453 GAAAGAACCTAAGAATTTTCTGG + Intronic
1028879395 7:95862812-95862834 TAAAGAACTTGAGCATACTCAGG - Intronic
1028940044 7:96511665-96511687 GTAAGAACCTGGGTATCCTCTGG - Intronic
1034235199 7:149561461-149561483 GATAGAGACTGAGCATGCTTTGG + Intergenic
1035922627 8:3694252-3694274 GGAAGAGCCTGGTCATGCTCAGG + Intronic
1037603494 8:20418617-20418639 GAATGAACTTGAGAAGGCTCAGG + Intergenic
1042218846 8:66453525-66453547 GAATGAGCCTTAGCTTGCTCTGG - Intronic
1042365648 8:67933481-67933503 GAAAGAACCTAAGCTGGATCTGG - Intergenic
1044186892 8:89264108-89264130 GAAAGAATCATAGCATGTTCTGG - Intergenic
1051493308 9:17691072-17691094 ATAAGAACCTTAGCATGCTAGGG + Intronic
1052149709 9:25100500-25100522 GAAAGAACCTTACCATATTCAGG + Intergenic
1057303255 9:93898593-93898615 AAGACAACCTGAGCATGGTCAGG + Intergenic
1057981186 9:99665436-99665458 GAAAGTACTTGGGCATGTTCCGG + Intergenic
1058110550 9:101027879-101027901 AAGAGAACCTGAGCCTGCTATGG - Intergenic
1058546444 9:106065296-106065318 GAAAGAACCCAAGGAGGCTCAGG - Intergenic
1059072148 9:111149148-111149170 AGCAGAACCTGAGCAAGCTCAGG + Intergenic
1059964202 9:119597616-119597638 GATAGGGCCTGAGCATGCTAAGG + Intergenic
1060315288 9:122504164-122504186 GACAGAACCTGAGAATTGTCAGG - Intergenic
1061101436 9:128495506-128495528 CAAAGTCCCTGAGAATGCTCAGG - Intronic
1061266829 9:129510964-129510986 GAAAGAATCTGAATATCCTCCGG + Intergenic
1062519753 9:136952728-136952750 GCAAGAACCAGAGCCTACTCTGG - Intronic
1062574300 9:137199409-137199431 GGAAGAAGCTGAGCCTGCTGAGG - Exonic
1186093208 X:6072000-6072022 AAAAGAACCCGAGCTTGCTGTGG - Intronic
1186917948 X:14244097-14244119 AAAAGAAGCTGAGGAGGCTCTGG - Intergenic
1187579425 X:20592529-20592551 GAGAGAATCTGTGCATGCTGGGG - Intergenic
1187933297 X:24313147-24313169 AAAAGAGCCTGAGGATCCTCAGG - Intergenic
1187938930 X:24362907-24362929 AAAAGAGCCTGAGGATCCTCAGG + Intergenic
1190690433 X:52908958-52908980 GGAAGAACCCAAGGATGCTCTGG - Intergenic
1190695550 X:52946834-52946856 GGAAGAACCCAAGGATGCTCTGG + Intronic
1195421719 X:104683019-104683041 GAAAGGAGCTAACCATGCTCTGG + Intronic