ID: 996072572

View in Genome Browser
Species Human (GRCh38)
Location 5:119150300-119150322
Sequence GTAAACTAGAATGAAGTAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996072572_996072574 -9 Left 996072572 5:119150300-119150322 CCACTTACTTCATTCTAGTTTAC 0: 1
1: 0
2: 2
3: 15
4: 229
Right 996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG 0: 1
1: 0
2: 1
3: 4
4: 73
996072572_996072578 13 Left 996072572 5:119150300-119150322 CCACTTACTTCATTCTAGTTTAC 0: 1
1: 0
2: 2
3: 15
4: 229
Right 996072578 5:119150336-119150358 GATGGAGCAGATGTCTTTGATGG 0: 1
1: 0
2: 3
3: 5
4: 214
996072572_996072575 -5 Left 996072572 5:119150300-119150322 CCACTTACTTCATTCTAGTTTAC 0: 1
1: 0
2: 2
3: 15
4: 229
Right 996072575 5:119150318-119150340 TTTACCAGGACTCAGCCGGATGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996072572 Original CRISPR GTAAACTAGAATGAAGTAAG TGG (reversed) Exonic
901346805 1:8551858-8551880 GTATAATAGACTGAAGTTAGAGG - Intronic
903983125 1:27204339-27204361 GTCACCTGGAATGAAGAAAGTGG - Intergenic
904926516 1:34053291-34053313 GACAATTAGAATGATGTAAGTGG + Intronic
905373021 1:37496207-37496229 GTTAAAAAGACTGAAGTAAGAGG + Intronic
905787309 1:40768599-40768621 GTAAACTAGAAAGAAGACTGCGG - Intronic
905845778 1:41230262-41230284 TTAGACTAGAATGAAGGAAGTGG + Intronic
907664585 1:56423715-56423737 GCAAACTAGACTGAAGGAAAGGG + Intergenic
908711483 1:67020443-67020465 TAAACCTAGAATGAAGAAAGAGG + Exonic
908900646 1:68952520-68952542 GTAAAGAAGAAAGAAGTAACAGG - Intergenic
909115510 1:71530023-71530045 TGAAAATAGATTGAAGTAAGTGG - Intronic
909789107 1:79651359-79651381 GGAAATCAGAATGAAATAAGAGG - Intergenic
911390877 1:97240628-97240650 TTAAAATATAATGAATTAAGTGG + Intronic
911466914 1:98266347-98266369 ATAAATTAGAATGAATTATGAGG + Intergenic
911676981 1:100669187-100669209 GTAACTTAGAATGAAGAAAGTGG + Intergenic
912321109 1:108714506-108714528 GTAAATAAGAATAAAGCAAGAGG - Intronic
915963165 1:160283803-160283825 GTAATCCAGAAGGAAGTAGGAGG - Intronic
917274076 1:173312020-173312042 ATAAACCAGAATCAAGTAAATGG - Intergenic
918024900 1:180733625-180733647 ATAATCTAGAAAGAAGTAAAAGG + Intronic
918418008 1:184332266-184332288 GTAAAGAAGAATGAAGCCAGTGG - Intergenic
921567578 1:216738613-216738635 GTCAAACAGAATGTAGTAAGGGG + Intronic
923478636 1:234361328-234361350 TTAGACTATAATGAAGTTAGAGG + Intergenic
1063529613 10:6818975-6818997 GTAAACCAGAATGAAAGAGGAGG + Intergenic
1063631924 10:7742052-7742074 GTAAGATAGAATGAAGTACATGG - Intronic
1065213385 10:23426031-23426053 GTAAATTGGAATGAATTAAAGGG - Intergenic
1065834868 10:29647551-29647573 GTACAATACAATCAAGTAAGAGG - Intronic
1067021996 10:42808942-42808964 AAAAACAAGAATAAAGTAAGAGG - Intronic
1068326423 10:55493703-55493725 GTAAACAAAAATGAAATAACTGG + Intronic
1071516800 10:86303366-86303388 AAAAACTCTAATGAAGTAAGAGG - Intronic
1072268637 10:93754276-93754298 GTAAGTTAGAAGGGAGTAAGAGG - Intergenic
1072280356 10:93860433-93860455 CTAAAGTAGAAGGCAGTAAGGGG + Intergenic
1075150489 10:119925223-119925245 GTTAACTAGAAAGAAGCATGAGG - Intronic
1077885994 11:6388506-6388528 GGAAAGTAGGATTAAGTAAGTGG - Intergenic
1079072445 11:17359338-17359360 GGAAACTAGAATGATCTATGTGG - Intronic
1080989176 11:37509095-37509117 GTAAACAAGGAGGAAGTAAAGGG - Intergenic
1081951012 11:47043034-47043056 CTAAACCACAATGCAGTAAGTGG + Intronic
1082262581 11:50088667-50088689 TTAAACTAGAATGAGCAAAGTGG + Intergenic
1085089364 11:73697064-73697086 TTACACTAGAGTGAAGGAAGGGG - Intronic
1086344244 11:85880042-85880064 AAAAACAAGAATAAAGTAAGAGG - Intronic
1087860176 11:103143605-103143627 GTAAAATAGACTGAAGAAAGAGG + Intronic
1088573853 11:111250675-111250697 AAAAACTAGAATAGAGTAAGGGG + Intergenic
1096313881 12:50546224-50546246 GTTAACTAGTATCAAGTGAGAGG + Intronic
1096720318 12:53516579-53516601 TTTAACTAGAATTAAGGAAGAGG + Exonic
1097095157 12:56541516-56541538 CTCAACTGGATTGAAGTAAGAGG - Intronic
1099881355 12:88470693-88470715 GTAAACTAGTGTGAAGGAACAGG + Intergenic
1100045677 12:90377203-90377225 TTTAACTACAATGAATTAAGAGG + Intergenic
1100458320 12:94774414-94774436 GGAAACTAGAATTGAGTAGGGGG + Intergenic
1101193303 12:102357019-102357041 GTAAGGTAGAATAAAGTTAGGGG + Intergenic
1106698613 13:32205471-32205493 ATAAACTAGCATGATGTAATTGG + Intronic
1107615836 13:42167179-42167201 GTAAGATAAAATGAACTAAGTGG + Intronic
1109571165 13:64191904-64191926 GAAAAAAAGAAGGAAGTAAGTGG + Intergenic
1110554686 13:76845288-76845310 ATAAAATAGAAACAAGTAAGTGG + Intergenic
1111654666 13:91137300-91137322 TTAAAATATAATGTAGTAAGAGG + Intergenic
1113164789 13:107427996-107428018 TTAAAGCAGAATGAAGTAATTGG + Intronic
1115718417 14:36131687-36131709 GTAAATTATAATGATGTAAGGGG - Intergenic
1116368233 14:44096634-44096656 GTAAACTAGAATCCAGAAATTGG - Intergenic
1116507926 14:45708342-45708364 TTAAACTAGAATGAAGTATGGGG - Intergenic
1116667103 14:47791644-47791666 GGAAACTAGAATGAACCACGTGG - Intergenic
1116784696 14:49274774-49274796 GAAAACTAGAATGTGGCAAGTGG - Intergenic
1117186779 14:53247647-53247669 GGAGACTAGAAAGAAGGAAGAGG + Intergenic
1118287933 14:64494055-64494077 AAAAAGTAGAATGAAATAAGAGG + Intronic
1120832276 14:89008167-89008189 TTAAACTAGAGTGAAGAAAGGGG + Intergenic
1120941645 14:89955694-89955716 GTTAACTAGAGCGAAGTTAGGGG + Intronic
1121006452 14:90493677-90493699 GTAAACTATCATAAACTAAGTGG - Intergenic
1122047078 14:99031472-99031494 GAAAAAAAGAATAAAGTAAGAGG - Intergenic
1123435959 15:20254600-20254622 CTAAACTATAAAGAAGTCAGTGG - Intergenic
1125468062 15:39974655-39974677 TTAAAATAGAATGAAGTTAAAGG - Intronic
1126337209 15:47599285-47599307 GTTGGCTAGAATGAAGTGAGGGG - Intronic
1128350584 15:66885754-66885776 GTAACCTCAAATGAAGGAAGGGG + Intergenic
1128443790 15:67738902-67738924 GTAAACTTCAAGGAAGTAATCGG - Intronic
1131937203 15:97519668-97519690 GAAAACAACAGTGAAGTAAGTGG - Intergenic
1132103713 15:99047406-99047428 GTAAAATAGAAGGAAGAAATGGG + Intergenic
1136848640 16:33596380-33596402 CTAAACTATAAAGAAGTCAGTGG + Intergenic
1137846480 16:51694426-51694448 GTAAACTAGAATGTTGTAATAGG + Intergenic
1203110347 16_KI270728v1_random:1445030-1445052 CTAAACTATAAAGAAGTCAGTGG + Intergenic
1146234738 17:31148037-31148059 GTGAGCTATAATGAGGTAAGGGG - Intronic
1147242329 17:39098749-39098771 GTAAAAAAGATTGGAGTAAGAGG + Intronic
1149719224 17:58826476-58826498 ATAAACTATATTGAAGCAAGAGG + Intronic
1150559340 17:66281363-66281385 GTGAACTATAATAAAATAAGGGG - Intergenic
1153152810 18:2113864-2113886 TTAGACTAGCATGATGTAAGAGG - Intergenic
1153718152 18:7872161-7872183 ATAAACTGGAATCATGTAAGTGG + Intronic
1155542267 18:26880836-26880858 GGATACTAGAATCAAGTTAGAGG + Intergenic
1155560014 18:27065541-27065563 GAAAGGTATAATGAAGTAAGAGG + Intronic
1156271949 18:35543397-35543419 GTAAAAAAGAATGAAGTACTAGG - Intergenic
1157222093 18:45835838-45835860 GGACACTACAATGAAGGAAGAGG + Intronic
1159783343 18:72684738-72684760 ATAAACTAGAATGAAGGGGGAGG + Intergenic
1164436706 19:28236641-28236663 GTGAACCAGAATGGAGAAAGGGG + Intergenic
1165032113 19:33005482-33005504 CTAAACTACAAAGAAGTCAGAGG - Intronic
1167471861 19:49680020-49680042 GTAAACTGGTTTGAAGCAAGAGG - Intronic
1168628536 19:57938377-57938399 GTAATCAAGAATCAAGAAAGAGG + Intergenic
924966740 2:83594-83616 CTAACCTGTAATGAAGTAAGGGG + Intergenic
925041985 2:739680-739702 GTAAACTAGAGAGTAGTTAGTGG + Intergenic
926860765 2:17306306-17306328 CTAAACTAGAATAGAGTTAGTGG - Intergenic
928800102 2:35079047-35079069 GTAAACTAGAAAGGAGAGAGAGG - Intergenic
929717857 2:44331570-44331592 GTAAACTAGAAAGGAGATAGGGG - Intronic
929718320 2:44336957-44336979 CTAAACCAAAAAGAAGTAAGGGG - Intronic
930517801 2:52431006-52431028 ATCAACAAGAATGAAGTCAGTGG + Intergenic
931385307 2:61793127-61793149 TTAAACTAGAATAAAATAAAAGG - Intergenic
932944550 2:76212354-76212376 GTAATCTAGAATGAAGCAGTAGG - Intergenic
935864713 2:107374572-107374594 GGAAGCTAGAATGAACTATGTGG + Intergenic
938920841 2:135993213-135993235 TTAAATTAGAATGAGGTAATTGG + Intergenic
939495684 2:142925365-142925387 ATAAACTAAGATGAAGGAAGAGG - Intronic
939862444 2:147436112-147436134 GTAAATTACAATGAACTATGAGG + Intergenic
943155671 2:184171980-184172002 ATAAACTTGAATGAAGTAATGGG + Intergenic
943522323 2:188968091-188968113 GTAAATTAAAATAAACTAAGAGG + Intergenic
943617096 2:190105450-190105472 GTAAATTAGAATAAAATAAGAGG - Intronic
943971996 2:194422176-194422198 GTAAACAAGAATAAACTCAGGGG - Intergenic
944549458 2:200832004-200832026 GAAGACTAGAATGATGAAAGAGG + Intergenic
944900496 2:204208973-204208995 GTAAATAATAATGAAGTGAGGGG - Intergenic
946830651 2:223725101-223725123 GGAAACAAGAATGAAGCAAAAGG - Intergenic
1168864344 20:1072574-1072596 CTAAACTAGAAGGAAGAGAGTGG - Intergenic
1169411485 20:5374314-5374336 TTTCACTAAAATGAAGTAAGCGG - Intergenic
1170967059 20:21082968-21082990 GAAATCTAGAATGAAGAATGGGG + Intergenic
1173348752 20:42225176-42225198 TGAAAATAGAATGAAGTAGGAGG - Intronic
1173458121 20:43220178-43220200 GAAACGTAGGATGAAGTAAGGGG + Intergenic
1173969079 20:47137110-47137132 TTAAACCAGAATGAACTGAGAGG - Intronic
1177374589 21:20253212-20253234 GGAAACTAGCAGGAAGCAAGTGG + Intergenic
1177440613 21:21118647-21118669 TGAAATTAGAAGGAAGTAAGGGG - Intronic
1177629476 21:23707849-23707871 GAAAGCGAGAATGAACTAAGAGG - Intergenic
1178509146 21:33188255-33188277 GAAAACTAGAATGAATCAAACGG - Intergenic
1179785648 21:43728328-43728350 GGAAACCAGAATGAGGAAAGAGG - Intronic
1180898152 22:19352318-19352340 GCAAACCAGAGTGGAGTAAGAGG + Intronic
1181319901 22:21996171-21996193 AGAAACCTGAATGAAGTAAGGGG - Intergenic
1181715691 22:24725977-24725999 GTAAATAAGAATGCGGTAAGGGG - Intronic
949130300 3:492151-492173 GAAAACTAGACAGAAGTCAGTGG + Intergenic
949201573 3:1386781-1386803 GTAAACTAGATTTTTGTAAGTGG - Intronic
949371811 3:3343515-3343537 GAAAACTATAATGAGGCAAGTGG - Intergenic
951003070 3:17586851-17586873 GCAAAGTTAAATGAAGTAAGAGG - Intronic
951555134 3:23913812-23913834 GAAACCTAGATTTAAGTAAGAGG - Intronic
951590119 3:24255577-24255599 GCCAACTAGAATGAAGTCAAAGG + Intronic
951869119 3:27340518-27340540 GTAAAATAAAATAAAATAAGTGG + Intronic
955378275 3:58416260-58416282 GTAAACAAGAAGGTAATAAGTGG - Intronic
956159100 3:66329712-66329734 GTAAAATTGAATAAAGTAGGAGG - Intronic
958015368 3:87934083-87934105 GCAAATTAGAAGGAAGTATGGGG - Intergenic
959331483 3:105011372-105011394 GTAAAAGAGAATCAAGAAAGAGG + Intergenic
960957143 3:123040935-123040957 GTAAAGTAGAATGAACAGAGCGG + Intergenic
961249749 3:125491711-125491733 GGAAACAATAATGAATTAAGGGG - Intronic
962053693 3:131846458-131846480 GGAAACTGGAATGATGTAATGGG - Intronic
963724102 3:148899975-148899997 GGAGAATAGAATGAAGAAAGAGG - Intergenic
966252758 3:177885094-177885116 GAAAACCAGAATGAAGTGGGAGG - Intergenic
966857766 3:184207175-184207197 GAAAACTAGAATGAACTCTGTGG + Intronic
969815370 4:9683179-9683201 GCAAGCTAACATGAAGTAAGTGG - Intergenic
970050718 4:11912084-11912106 GTAAATTAGAATACAATAAGGGG + Intergenic
971107857 4:23546518-23546540 GTAAAATAAAATAAAATAAGTGG + Intergenic
971857692 4:32063136-32063158 ATAAAGTAGAAAGAAGAAAGTGG + Intergenic
974095194 4:57355889-57355911 ATAAACTAGAAGGAATTAACTGG - Intergenic
975385396 4:73753187-73753209 GCAAAGTAGCATGCAGTAAGTGG - Intergenic
975494875 4:75026819-75026841 GTAAATTAGCATGAACAAAGGGG - Intronic
976817396 4:89165010-89165032 TAAAAATAGAATGAAATAAGAGG - Intergenic
978987516 4:115031775-115031797 ATAAACTAGAATTAAGAAAGGGG + Intronic
979721262 4:123903340-123903362 AGAACCTAGAAAGAAGTAAGAGG + Intergenic
979744633 4:124196303-124196325 GAAAACTAGAATGAGTAAAGGGG - Intergenic
980482325 4:133402693-133402715 GTAAAATAGAGTGAAATAAAAGG + Intergenic
980497187 4:133601219-133601241 CTAAATTAAAATGAAGTAAGAGG - Intergenic
984132230 4:175892253-175892275 GTAAGTTCGAATGAAATAAGAGG - Intronic
988124964 5:27019162-27019184 TTGAACTAGAATGAAGTATTTGG + Intronic
990166284 5:52996818-52996840 TTAAACTAGATAGAAATAAGGGG - Intronic
990810686 5:59719402-59719424 GTAAAATATAATGAAGTACTTGG + Intronic
992098618 5:73383934-73383956 GAAAACTAGAGTGACGTTAGGGG + Intergenic
993199846 5:84801066-84801088 GCAAACTGGAATGAAATAAATGG + Intergenic
994098643 5:95870713-95870735 GTAAAAGGGAATGAAGAAAGAGG - Intergenic
994502722 5:100600625-100600647 ATATAATAGACTGAAGTAAGTGG + Intergenic
995014921 5:107299226-107299248 GCTAACTAGAATCAAGAAAGTGG + Intergenic
995234457 5:109811074-109811096 GAAAAATACAATGAAGTAAAAGG - Intronic
995430146 5:112065521-112065543 GGATATTAGAATGAAGCAAGGGG - Intergenic
996072572 5:119150300-119150322 GTAAACTAGAATGAAGTAAGTGG - Exonic
997383760 5:133456446-133456468 GTAAGCTACACTGAAGAAAGGGG - Intronic
997553921 5:134778339-134778361 GAAAAATAGAATAAAGTGAGGGG - Intronic
1000148481 5:158476345-158476367 TTAAACTAGAATGAATGAAGTGG - Intergenic
1000512826 5:162204801-162204823 GAAAACTGGCATGAATTAAGTGG + Intergenic
1003237324 6:4307689-4307711 GTAGACTTGAAAAAAGTAAGAGG + Intergenic
1003709174 6:8569710-8569732 GTATACTGGAATGAATTTAGAGG + Intergenic
1004287492 6:14335472-14335494 ATAAACTAAAAAGAAGTAGGGGG + Intergenic
1006355551 6:33555028-33555050 GTAAACTAGGCTGAGGTCAGTGG - Intergenic
1006748153 6:36359595-36359617 ATAAAATAGAATCAAGTGAGAGG - Intronic
1006764000 6:36488873-36488895 CTTCACTAGAATGTAGTAAGTGG + Exonic
1008374072 6:50771463-50771485 GAAAAGGAGAATGAAGTCAGAGG + Intronic
1008470964 6:51884462-51884484 AAAAAGAAGAATGAAGTAAGAGG - Intronic
1009596040 6:65738230-65738252 AGAAAGTATAATGAAGTAAGAGG - Intergenic
1011425470 6:87224088-87224110 GTATACTAGGATTAAGTAAATGG - Intronic
1011928788 6:92683431-92683453 GTAAGCTAGAATGGGGTAGGAGG - Intergenic
1012891883 6:104906368-104906390 GAAAACAAGAAAGAAGAAAGAGG - Intergenic
1013203153 6:107921286-107921308 GTAAACTTGATTAAATTAAGTGG - Intronic
1013726703 6:113106770-113106792 GAAAACTAGAATTATGAAAGAGG + Intergenic
1013910242 6:115267126-115267148 ATAAAGTAGAATAAAGAAAGGGG + Intergenic
1014317273 6:119883643-119883665 GAAAACTAGAATGAACTCTGTGG - Intergenic
1014995594 6:128139062-128139084 GAAAAATAGCATGAAGTCAGAGG + Intronic
1015132191 6:129825137-129825159 GGAAAGTATAATGTAGTAAGGGG - Intergenic
1015755928 6:136606433-136606455 GTATAATAGAAAGAATTAAGTGG + Intronic
1016191303 6:141268610-141268632 ATATAATAGACTGAAGTAAGCGG - Intergenic
1016662414 6:146597045-146597067 TTAAATTAGGATAAAGTAAGGGG - Intergenic
1016812699 6:148276546-148276568 GTAAGCTAGGATGGAGGAAGAGG + Intronic
1017587194 6:155939765-155939787 CAAAAGTAGAATGAAGAAAGAGG - Intergenic
1018139812 6:160819978-160820000 GTAAACAAGAAAAAAGTGAGAGG - Intergenic
1019665340 7:2249457-2249479 GTAACCGGGAATGAAGGAAGTGG + Intronic
1022143818 7:27516806-27516828 GCAAACAAGAAGGTAGTAAGTGG - Intergenic
1023169016 7:37372730-37372752 GTAAACTAGACTGAAGGGACTGG - Intronic
1023315230 7:38929324-38929346 GGAAACTGTAATGAAGGAAGTGG - Intronic
1024863046 7:53868396-53868418 ATAAAATAAAATAAAGTAAGAGG + Intergenic
1025184759 7:56849128-56849150 TTAAACTAGAATGAGCAAAGTGG + Intergenic
1025590585 7:62855182-62855204 AAAAACTAGAATGAAGTTATTGG + Intergenic
1025687171 7:63727834-63727856 TTAAACTAGAATGAGCAAAGTGG - Intergenic
1027742801 7:82033509-82033531 ATAAAGTAGAATGAATAAAGAGG - Intronic
1028634135 7:92968078-92968100 GTTAAATAGAATGGAGTAAGAGG + Intergenic
1030768908 7:113448669-113448691 GTAAACTAAAATGAAGTTATTGG - Intergenic
1032890341 7:136188225-136188247 ATAGACTAAAATGAAATAAGAGG + Intergenic
1034077632 7:148247952-148247974 GTAAAGTTGACTGAAGAAAGAGG - Intronic
1034138001 7:148789337-148789359 ATACACTATAATGAAGTTAGCGG + Intronic
1034149292 7:148901197-148901219 GAAAACTAGAATGCAGTGTGAGG - Intergenic
1037326691 8:17698934-17698956 ATAAACTGGGATGAAGTAAAAGG - Intronic
1038001248 8:23393264-23393286 GAAAAGGAGAACGAAGTAAGAGG + Intronic
1040133548 8:43826094-43826116 ATAAACTAGAAAGAAGTTATTGG + Intergenic
1041334621 8:56767355-56767377 TTAAACTAGAATTCAGTAACAGG - Intergenic
1041444645 8:57937190-57937212 TTAAACTAGAATGAAATATTTGG - Intergenic
1043806018 8:84672497-84672519 GTAAATTAGTACGAAGTAATGGG - Intronic
1044895224 8:96884614-96884636 GAAAATGAGAATGAAGAAAGGGG + Intronic
1045855306 8:106758042-106758064 GTAAACTAGAATTTTGTCAGTGG - Intergenic
1045957944 8:107931549-107931571 GTAAAATAGAATAAAGTCTGTGG + Intronic
1046558252 8:115803879-115803901 GAAAACTAAAATGCTGTAAGGGG - Intronic
1046899808 8:119511813-119511835 AGAATCTAGAATAAAGTAAGGGG - Intergenic
1047048018 8:121076535-121076557 GTAAAGCAGAATGAAGTGTGAGG + Intergenic
1047239743 8:123075346-123075368 GTATACTAAATTGAATTAAGTGG - Intronic
1048734138 8:137479543-137479565 GGAAACTAGAATGAGCTAGGGGG + Intergenic
1050062138 9:1720479-1720501 CCAAACTAGAAGGAACTAAGAGG + Intergenic
1050939673 9:11443097-11443119 GTAAAATAGAGTGAAGCAGGGGG - Intergenic
1052094954 9:24372715-24372737 GTTAAGAAGAATTAAGTAAGGGG + Intergenic
1052112373 9:24602744-24602766 GAAAACTAGAAAGGAGAAAGGGG - Intergenic
1052297504 9:26914182-26914204 GTAAACTACAAAAATGTAAGTGG + Intronic
1053157156 9:35789523-35789545 GTTAACTAGAAAGTAGGAAGGGG - Intergenic
1055400287 9:75916571-75916593 AAAAACGAGAAGGAAGTAAGAGG + Intronic
1056411942 9:86337611-86337633 GTAAACAAGAATGAGGTTACAGG - Intronic
1057085045 9:92202337-92202359 GCAAAATACCATGAAGTAAGAGG + Intergenic
1057765057 9:97909300-97909322 GTAGCCTAGGATGAAGGAAGGGG - Intronic
1059020535 9:110571675-110571697 GTAAACTAGAATGAATGAAGTGG - Intronic
1061460713 9:130736305-130736327 GTAAACTAGAATGATGTCTACGG - Intronic
1186536355 X:10353293-10353315 ATAACCCAGAATGAAGTAATGGG + Intergenic
1186592157 X:10942164-10942186 CTAAACAAGAATGTATTAAGTGG + Intergenic
1187260358 X:17679841-17679863 TTTAACCAGAATGAAGAAAGGGG + Intronic
1188709811 X:33381490-33381512 GTAAACTACTATGTAATAAGAGG + Intergenic
1190417895 X:50199171-50199193 GTTAGCTAGAATTAAGTTAGAGG - Intronic
1191264973 X:58379109-58379131 ATAAACTAGAAAGAAGTGATTGG - Intergenic
1192628592 X:72756526-72756548 GTCAAGTAGAATGAAGAATGAGG + Intergenic
1192653116 X:72964288-72964310 GTCAAGTAGAATGAAGAATGAGG - Intergenic
1193974579 X:88101635-88101657 GTCAAGTAAAATGAAGTGAGTGG + Intergenic
1194309471 X:92286576-92286598 TTAATCTAGAATGAAATAAGTGG - Intronic
1198802028 X:140457879-140457901 GGTAAGTTGAATGAAGTAAGGGG - Intergenic
1199494547 X:148438626-148438648 GGAAAATAAAATGAAGTAAATGG + Intergenic
1200617763 Y:5400831-5400853 TTAATCTAGAATGAAATAAGTGG - Intronic