ID: 996072574

View in Genome Browser
Species Human (GRCh38)
Location 5:119150314-119150336
Sequence CTAGTTTACCAGGACTCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996072572_996072574 -9 Left 996072572 5:119150300-119150322 CCACTTACTTCATTCTAGTTTAC 0: 1
1: 0
2: 2
3: 15
4: 229
Right 996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG 0: 1
1: 0
2: 1
3: 4
4: 73
996072570_996072574 17 Left 996072570 5:119150274-119150296 CCTGAGCATGCTCAGGTTCTTTC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG 0: 1
1: 0
2: 1
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996072574 Original CRISPR CTAGTTTACCAGGACTCAGC CGG Exonic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
918976614 1:191495292-191495314 TCAGTTTACAAGGCCTCAGCTGG + Intergenic
924161572 1:241238375-241238397 CTCGGTTAGCAGGACTCAGATGG - Intronic
1063279983 10:4617690-4617712 CTAGATTCCCAGGAATAAGCTGG + Intergenic
1064528556 10:16283695-16283717 GTAGTTAACCAGGACTTAGGTGG - Intergenic
1074014544 10:109520792-109520814 CTAGTTTACCAGGACTATCAGGG + Intergenic
1076201615 10:128563504-128563526 CTGCTGTTCCAGGACTCAGCAGG + Intergenic
1076286072 10:129297650-129297672 CTAGTTTCCCATGATTCTGCAGG + Intergenic
1084441299 11:69175204-69175226 TGAGTTTGCCAGAACTCAGCTGG - Intergenic
1085772021 11:79334234-79334256 ATAGTCTGGCAGGACTCAGCTGG + Intronic
1085920197 11:80945502-80945524 CTTGTATTCCAGGACTCACCTGG + Intergenic
1086823834 11:91470613-91470635 CTAGTTCACCTGGAATCAGGTGG - Intergenic
1088598388 11:111456225-111456247 CGGGATTCCCAGGACTCAGCAGG - Intronic
1098059384 12:66544083-66544105 CTAGATTTTCAGGATTCAGCCGG - Intronic
1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG + Intronic
1116418028 14:44701665-44701687 CTAGTCTAAGATGACTCAGCAGG + Intergenic
1121864082 14:97346349-97346371 CTAGAATAACAGGACTCAGGGGG - Intergenic
1124856084 15:33390729-33390751 CTAGATTCCCAGAACTAAGCAGG - Intronic
1125245227 15:37628945-37628967 CTAATTTATCAAGACTCAGTGGG - Intergenic
1132520335 16:384297-384319 CAAGTTCACCAGCCCTCAGCTGG - Intronic
1137747642 16:50834860-50834882 CAAGTGGACCAGAACTCAGCGGG + Intergenic
1137932290 16:52600557-52600579 CTAGTTTAGCTGGGCCCAGCTGG + Intergenic
1140958475 16:79889726-79889748 TTGGTTTAACTGGACTCAGCTGG + Intergenic
1140959989 16:79902520-79902542 CTTATGTGCCAGGACTCAGCTGG + Intergenic
1150994818 17:70305250-70305272 CTGGTTTGCCAGGACTCAGTGGG - Intergenic
1156514371 18:37667785-37667807 CTTGTTTTCCAGGGTTCAGCTGG + Intergenic
1160247618 18:77171681-77171703 CTAGCTTAACAGGAGACAGCTGG + Intergenic
1160704288 19:522710-522732 CCAGTTTCCCAGCACTGAGCTGG + Intergenic
1162154142 19:8665147-8665169 CTAGGTTCCCAGGACCCAGTGGG - Intergenic
1165084470 19:33333977-33333999 TGAGTTTACCAGAACCCAGCTGG - Intergenic
1165274844 19:34739618-34739640 CTCGTTCACCATGACTCACCTGG - Exonic
927805003 2:26139303-26139325 CGAGTTTACCATGACTCCCCAGG - Intergenic
931840832 2:66146486-66146508 CTAGTTTCCCTGTACTCTGCTGG - Intergenic
937457672 2:122056673-122056695 CTAGTTTAATAGGAGACAGCTGG - Intergenic
938196322 2:129331899-129331921 CTACTTTACCAGTACTCATGAGG - Intergenic
946060289 2:216935307-216935329 CTACTTTTCCAGGACTCCTCCGG + Intergenic
948487494 2:238290019-238290041 CTTCTTTACCTGGACTCACCTGG + Intronic
1169181686 20:3574585-3574607 CAAGATTACCAGAACTTAGCAGG + Intronic
1169580431 20:7016700-7016722 CTAGCTTACCATCACTCAGTTGG - Intergenic
1172300313 20:33845276-33845298 CTTGTTCACCATCACTCAGCAGG + Intronic
1174741922 20:53022967-53022989 CTGGTTTTCCAGGACTCTGCTGG + Intronic
1178304306 21:31478283-31478305 CTATTTTAAGAGGACTCATCTGG - Intronic
1184160868 22:42696612-42696634 CTAGGTTCCCAGCACGCAGCAGG + Intronic
950564626 3:13761013-13761035 ATACTTTACCAGGCCCCAGCGGG - Intergenic
952711944 3:36440358-36440380 CAATTTGACAAGGACTCAGCTGG + Intronic
954635192 3:52067342-52067364 CTGGGTCACCAGGACCCAGCTGG + Intergenic
954777130 3:53029735-53029757 TTAGTCTCCCAAGACTCAGCTGG + Intronic
955375835 3:58396450-58396472 CTAGTTCACCAGGACATTGCAGG + Intronic
965605656 3:170495653-170495675 CCAGGTTAACAGGGCTCAGCAGG - Intronic
971244358 4:24914650-24914672 CTAGTTGAGCAAGGCTCAGCTGG - Intronic
971263638 4:25078726-25078748 CTAATACACCAGGGCTCAGCAGG - Intergenic
974079900 4:57201212-57201234 CTAGTTGATCAGGTCTCACCGGG - Intergenic
975286890 4:72631655-72631677 CTAGTTTTCCTGGACTAATCTGG + Intergenic
979779112 4:124626974-124626996 ATAGTTTGCCTGGACTCAGTGGG - Intergenic
989672554 5:43935967-43935989 CTATTTTGCCAGGGCTCAGCTGG - Intergenic
991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
1004328799 6:14702078-14702100 CTTGTTTTTCAGCACTCAGCAGG - Intergenic
1007268137 6:40612508-40612530 CCAGTTTGCCAGGACTAAGGTGG + Intergenic
1012960024 6:105612570-105612592 CTAGTTGACCAAGACCCAGCTGG + Intergenic
1016580873 6:145628406-145628428 AGAGTCTACCAGGCCTCAGCAGG - Intronic
1018540328 6:164872895-164872917 ATAGTTTCCCAGGAGTGAGCTGG - Intergenic
1021942534 7:25692612-25692634 CTAGTTTAATAGAACACAGCTGG + Intergenic
1022182369 7:27933766-27933788 CAAGCTTGCCAGAACTCAGCAGG - Intronic
1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG + Intergenic
1028283502 7:88964502-88964524 GTGGTTTACCAGGAGTCAGGAGG + Intronic
1028590984 7:92494325-92494347 CTAGTCGACCAGGCCTAAGCAGG + Exonic
1035207943 7:157306958-157306980 CAAGTCCACCAGGGCTCAGCGGG - Intergenic
1040279576 8:46032152-46032174 CTAATTGACCAGAACTCTGCAGG + Intergenic
1041759287 8:61346619-61346641 CTAGTTTACAAGGAGGCATCAGG - Intronic
1043296322 8:78667060-78667082 CTAGTTTACACGGATTCAGTTGG + Intronic
1046501929 8:115088859-115088881 CTAGTTTATCAAGGATCAGCTGG + Intergenic
1047847434 8:128823001-128823023 CTGGTTTACCTGGTCTCAGGTGG - Intergenic
1050332410 9:4558586-4558608 CTTGTACTCCAGGACTCAGCTGG - Intronic
1050540533 9:6665723-6665745 CTAGTTTACAGGGACTCAGCTGG - Intergenic
1192362639 X:70449247-70449269 CTAGTTCTCCAGGCCTCAGAAGG - Intronic
1196467773 X:115990883-115990905 CTATTTTACCATGGCTAAGCTGG - Intergenic
1197581428 X:128288615-128288637 CTATTGTACCATGACTGAGCTGG - Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic