ID: 996074173

View in Genome Browser
Species Human (GRCh38)
Location 5:119169866-119169888
Sequence CAGACTGAGGAGAAGTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996074168_996074173 30 Left 996074168 5:119169813-119169835 CCTAGGAGACTCTCAGTGTTCAA 0: 1
1: 0
2: 0
3: 17
4: 152
Right 996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG 0: 1
1: 0
2: 1
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996074173 Original CRISPR CAGACTGAGGAGAAGTGTTC AGG Intronic
900720784 1:4174553-4174575 CGGACAGAGGAGGTGTGTTCTGG + Intergenic
904252023 1:29231783-29231805 TAGTCTGAAGAGAAGTGCTCTGG + Intergenic
904296474 1:29522488-29522510 CAGAGTGAGGAAAGGTGATCTGG - Intergenic
904409850 1:30318948-30318970 CAGAGTGAGGACAGGTGATCTGG + Intergenic
904606534 1:31700959-31700981 CTGACTGAGCAGAAGTGTTGGGG + Intronic
904780604 1:32944209-32944231 CAGACTGGGAAGAAGAATTCAGG - Intronic
910204607 1:84735755-84735777 CAAACTGAGGAGAAATTTTAGGG + Intergenic
911442859 1:97950564-97950586 CATACTGAGCAGAGGTTTTCTGG - Intergenic
911449080 1:98042458-98042480 AAGACAGAGGAGAAGTGCTAAGG - Intergenic
911947972 1:104136404-104136426 ATGACTGAGAAGAATTGTTCTGG - Intergenic
912501457 1:110125257-110125279 CAGACTAAAGAGATGTGTTGGGG + Intergenic
912523004 1:110259256-110259278 CACACTGAGAGAAAGTGTTCCGG - Intronic
914448174 1:147768009-147768031 CAGCCTCAGGAGAAATGATCAGG + Intronic
915606076 1:156951825-156951847 AAGAGTCAGGAGATGTGTTCTGG + Intronic
915675467 1:157526125-157526147 AAGACTGAGAAGAAGTGGCCAGG + Intronic
916292681 1:163183967-163183989 AATGCTGAGGAGAAGTTTTCAGG - Intronic
1062846746 10:713113-713135 CAGAAAGAGGAGAAGTGTAAAGG + Intergenic
1063935519 10:11073717-11073739 CTGACTGAGGAGAAGGGGCCAGG + Intronic
1068117785 10:52752962-52752984 CAGAGTGAGGAGCAGTGAGCAGG - Intergenic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1071150225 10:82625683-82625705 AAGATTGAGGAGAAATGTTTGGG - Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071972419 10:90921555-90921577 CAGCCTGAGGGGAAGGGATCTGG + Intergenic
1072936265 10:99716602-99716624 CAGCCTGTGGAGGAGTGATCAGG - Intronic
1078897534 11:15610319-15610341 GAGACTGAGGAGCAGTGCTCTGG + Intergenic
1083460890 11:62811081-62811103 CAGACTGAGGAGGAAGGTTGAGG - Intronic
1085462393 11:76701996-76702018 CAGAACGAGGAGAAGGGTTGGGG + Intergenic
1088430690 11:109755325-109755347 CAGACTGAGGAGAGGCATTTTGG + Intergenic
1094216113 12:27944503-27944525 AAGGCTGGGGAGGAGTGTTCAGG + Intergenic
1099741101 12:86635485-86635507 AACACTGAGGAGAAGCATTCGGG - Intronic
1100703209 12:97170429-97170451 CAGACTGAAGAGAACGTTTCTGG + Intergenic
1102406156 12:112676089-112676111 CAGACTGGGGAGAAATATCCTGG + Intronic
1103937501 12:124484372-124484394 CACACTGCGGAGGAGGGTTCAGG - Intronic
1104222541 12:126798901-126798923 CAGAAAGAGGAGGAGTGTTATGG + Intergenic
1104698407 12:130882232-130882254 CAGACGGAGGAGGAGTTCTCAGG - Intergenic
1104698426 12:130882366-130882388 CAGACGGAGGAGGAGTTCTCAGG - Intergenic
1104698445 12:130882500-130882522 CAGACGGAGGAGGAGTTCTCAGG - Intergenic
1104698464 12:130882634-130882656 CAGACAGAGGAGGAGTTCTCAGG - Intergenic
1104698481 12:130882772-130882794 CAGACGGAGGAGGAGTTCTCAGG - Intergenic
1107100106 13:36581128-36581150 CAGAATGAGGAGATGTGGTTTGG - Intergenic
1109294644 13:60514576-60514598 AAGACTGAGGGGAAGTGTTGGGG + Intronic
1110958860 13:81594650-81594672 CAGATTGAGAAGAAGTATACTGG + Intergenic
1111775103 13:92651395-92651417 TAGACTGAGGTTATGTGTTCTGG - Intronic
1111813981 13:93127397-93127419 GAGACTGGGGAGAAGGGTGCAGG + Intergenic
1112555575 13:100465316-100465338 CAAGCTTAGGAGCAGTGTTCTGG + Intronic
1112882910 13:104131632-104131654 CAGCATGAAGAGGAGTGTTCAGG + Intergenic
1113164480 13:107423272-107423294 CAGTCTGAGGAGCAGAGGTCAGG + Intronic
1114181550 14:20372275-20372297 CAGAATGAGTAGGAGTTTTCTGG - Intronic
1115133247 14:30078370-30078392 GAGCCAGAGGAGAAGGGTTCAGG - Intronic
1115517203 14:34197854-34197876 GAGACTGAGGAGATGGTTTCAGG + Intronic
1118667265 14:68084562-68084584 CAGACTGATGAAAGCTGTTCAGG - Intronic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1120048280 14:79833966-79833988 CAGGCAGAGGAAAAGAGTTCTGG + Intronic
1202887472 14_KI270722v1_random:121311-121333 CAGACCCAGCAGCAGTGTTCTGG + Intergenic
1124968857 15:34464107-34464129 TAGACTGAGGTTATGTGTTCTGG - Intergenic
1127593340 15:60450535-60450557 CAGATTGAAGAGAGGTCTTCTGG - Intronic
1127655159 15:61048709-61048731 CACACAGATGAGAATTGTTCAGG - Intronic
1129591634 15:76920340-76920362 CAGACTGAGGAAGAGGATTCAGG + Intergenic
1131265243 15:90911658-90911680 CAGGCTGAGGACAAGTGTCCTGG + Intronic
1132190418 15:99851292-99851314 TAGACTGAGGTTATGTGTTCTGG + Intergenic
1132697479 16:1208347-1208369 GAGACTGAGAAAGAGTGTTCTGG + Intronic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1134739097 16:16526639-16526661 TAGACTGAGGACAAATTTTCAGG + Intergenic
1134928404 16:18185512-18185534 TAGACTGAGGACAAATTTTCAGG - Intergenic
1139429572 16:66903986-66904008 CAGACTGAGGATGAGTCTCCAGG + Intergenic
1142146027 16:88493273-88493295 CGGAGTGAGGAGAGCTGTTCCGG + Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1148020755 17:44551855-44551877 GAGACTGAGAAGAGGTGTTTGGG - Intergenic
1148549056 17:48539382-48539404 CAGACTGACGAGCAGCTTTCCGG + Intergenic
1150713215 17:67549151-67549173 CAGACTGATTAGAAGAGTTCAGG + Intronic
1150829031 17:68502088-68502110 CAGACTCCTGAGAAGTGTTCAGG + Intergenic
1151560478 17:74866951-74866973 CAGACAGAGCAGGAGAGTTCAGG + Exonic
1203156698 17_GL000205v2_random:10771-10793 CAGACACAGCAGGAGTGTTCTGG + Intergenic
1203159448 17_GL000205v2_random:35774-35796 CAGACCCAGCAGCAGTGTTCTGG + Intergenic
1153679095 18:7483723-7483745 CAGATTGAGTAGAAGTGTTCAGG + Intergenic
1160073641 18:75650908-75650930 CAGACTAGGGAGATCTGTTCAGG + Intergenic
1160225871 18:77010031-77010053 CAGAGTGAGGAGGAGTGAGCGGG + Intronic
1163831364 19:19548603-19548625 CAGACTGAGGGGGTGTGGTCTGG - Intergenic
1202662879 1_KI270708v1_random:88155-88177 CAGACCCAGCAGCAGTGTTCTGG + Intergenic
928633978 2:33223845-33223867 CAGACTGAAGAGAAATATTATGG + Intronic
930326217 2:49922193-49922215 CAGGCTCAGCAGAAGTGATCCGG - Exonic
934648636 2:96073852-96073874 CAGGCTGAGGAGAAATGTTTTGG - Intergenic
935215890 2:100975107-100975129 CAGAGTGTGGAGAGGTGATCAGG - Intronic
936101144 2:109580830-109580852 CTGACTGGGGACAAGTGTCCCGG + Intronic
936457763 2:112688524-112688546 CAGAATGAGAAGATGGGTTCTGG - Intergenic
938283974 2:130092001-130092023 CAGAGTGAGAAGAATTTTTCAGG - Intronic
938334619 2:130480565-130480587 CAGAGTGAGAAGAATTTTTCAGG - Intronic
938355205 2:130640105-130640127 CAGAGTGAGAAGAATTTTTCAGG + Intronic
938431633 2:131246892-131246914 CAGAGTGAGAAGAATTTTTCAGG + Intronic
939678756 2:145104771-145104793 CAGACTGAAAAGAAATGTTTGGG + Intergenic
942419385 2:175792395-175792417 CAGACCAAGGACTAGTGTTCTGG - Intergenic
943408640 2:187519202-187519224 CTGTTGGAGGAGAAGTGTTCTGG + Intronic
944504634 2:200398051-200398073 CAGGCTGATGAGGAGTGTTTAGG + Intronic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
948686076 2:239670492-239670514 CAGAGGGAAGAGAAGTGTCCTGG - Intergenic
1169677606 20:8172233-8172255 AAGAGTGATGAGAAGAGTTCAGG + Intronic
1169868923 20:10230884-10230906 CAGAGTGAGGACAAGTGTGTGGG + Intronic
1170045531 20:12081239-12081261 AAGATTAAGGAGAAGTATTCTGG - Intergenic
1171351792 20:24508019-24508041 CAAACTACGAAGAAGTGTTCTGG + Intronic
1171354652 20:24534511-24534533 CAGACCGAGGGGCACTGTTCCGG - Intronic
1172654611 20:36529196-36529218 CAGCCTGGGCAGGAGTGTTCTGG + Intergenic
1172747457 20:37223350-37223372 CAGACTGTGAGGAAGTGATCAGG - Intronic
1172892833 20:38279050-38279072 CAGGCAGAGGGGAAGTGGTCAGG + Intronic
1173503912 20:43572239-43572261 CCCACTCAGGAGAAGTGTTTGGG - Intronic
1174776155 20:53345087-53345109 CAGACAGAAGGGAAGTGGTCAGG + Intronic
1177571065 21:22887893-22887915 CTGACTCAGTAGAAGTGTTGGGG - Intergenic
1178905915 21:36635977-36635999 GAGACTGAACAGAAGTGTTAAGG + Intergenic
1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG + Intergenic
950274071 3:11643376-11643398 CACACTGAGGAGGAGTGGCCGGG + Intronic
951728988 3:25790110-25790132 CCGACTGTGGAGAAGTGTCCGGG + Exonic
952657697 3:35806439-35806461 CAAAATGATAAGAAGTGTTCTGG + Intergenic
954316757 3:49805706-49805728 GAGCCTGAGGAGGAGTCTTCAGG - Intronic
954790054 3:53125755-53125777 TAGGCTGAGGAGAAGCGTGCAGG - Intronic
955098748 3:55826200-55826222 CAGAATGAAGACAAGTGTGCTGG - Intronic
955240216 3:57171111-57171133 CAGAGAGAGGAGAACTGTTCTGG + Intergenic
959477811 3:106832674-106832696 CATGCTGAGGAGGAGTGTTATGG + Intergenic
960815134 3:121664248-121664270 CAGATTAAGCAGAAGCGTTCAGG + Exonic
961459375 3:127040515-127040537 CAGATTGTGGAGAAGTGCGCAGG + Intergenic
965687005 3:171314800-171314822 TAGAGTGAGGAGAAGGATTCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
970108830 4:12615302-12615324 CAGCTTGAGGAGAAGATTTCAGG - Intergenic
971742220 4:30535260-30535282 GGGCCTAAGGAGAAGTGTTCAGG + Intergenic
972373968 4:38453015-38453037 CAGATTTGGGAGAAATGTTCAGG + Intergenic
973645907 4:52951046-52951068 CAGTCTCAGGATAAATGTTCGGG - Intronic
974433251 4:61825920-61825942 GGGACTGAGGAGCAGTGATCAGG - Intronic
975047047 4:69818235-69818257 CAGACTGAACACAAGTGTCCTGG + Intronic
976936861 4:90646855-90646877 CAGACAGAGCAAAAGTGTCCTGG + Intronic
982397447 4:154927416-154927438 TAGACTGAGAAGAAGTGGTCAGG - Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
984290642 4:177789649-177789671 GAGACTGAGAGGAAGTTTTCTGG + Intronic
984785090 4:183560465-183560487 CAGACTGAGGTGAAATCTTCGGG - Intergenic
986248461 5:6032357-6032379 CAGAGTGAGGAGATGAGATCAGG + Intergenic
987238855 5:15972014-15972036 CAGAATGAGGCGAAGTGACCTGG + Intergenic
989815086 5:45726435-45726457 TAAACTGAGGAGAAGTATTTGGG + Intergenic
990264917 5:54064577-54064599 AAGACTTGGGAGAAGTATTCAGG - Intronic
990488812 5:56284266-56284288 CAGACTGGGAAGAACTGTTCTGG - Intergenic
991556365 5:67899259-67899281 CAGTTAGAGGAGGAGTGTTCAGG - Intergenic
993447452 5:88031028-88031050 GAGAGTAAGTAGAAGTGTTCAGG - Intergenic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
997408221 5:133669372-133669394 CAGGCTGTGAAGAAGTGCTCAGG - Intergenic
998592666 5:143494521-143494543 CAGACTGAAGAGAAGTTCTTAGG - Intergenic
1004740114 6:18451564-18451586 CAGAGTGACGAGAAGTGTCCAGG + Intronic
1006741352 6:36311300-36311322 CAGACTGAGGATAAGGGTGTGGG + Intergenic
1010621675 6:78084670-78084692 CAGACTGAGGAGGAGTGAAGTGG + Intergenic
1011793542 6:90926910-90926932 CAGCTTGAGAAGAAGTGCTCTGG - Intergenic
1012703523 6:102493935-102493957 GAGGCTGAGGGGAATTGTTCTGG - Intergenic
1015850853 6:137570387-137570409 TAGACAGTGGAGATGTGTTCTGG + Intergenic
1016285230 6:142464916-142464938 GAGTGTGAGGAGAACTGTTCTGG + Intergenic
1017890150 6:158631165-158631187 CAGCCTCACGAGATGTGTTCAGG + Intronic
1018166205 6:161099613-161099635 CAGACTGAAGAGAAGTGATTTGG + Intronic
1018629125 6:165806783-165806805 CACACTGAGGAGAAATCATCTGG + Intronic
1019448174 7:1082172-1082194 CAGACTGAGAGGAAGTGGTTTGG - Intronic
1024716044 7:52080249-52080271 CAGACAGGTGAGAAATGTTCAGG + Intergenic
1028160551 7:87479888-87479910 GAGACTGAGGAAGAGTGATCAGG - Intronic
1030953956 7:115827403-115827425 GAGACAGAGGAGGAGGGTTCTGG + Intergenic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1040915493 8:52564067-52564089 AAGCCTGAGGAGAAGGGATCAGG + Intronic
1042691285 8:71502163-71502185 CAGAGGGAAGAGAAGTGATCTGG - Intronic
1043305715 8:78791771-78791793 CAGACTGTAGAGAAGTGGTGGGG - Intronic
1044548045 8:93481443-93481465 CAGACTGGGTAAAAGTGTGCAGG + Intergenic
1044918156 8:97137977-97137999 CAGTCTGAGGAGAAGTGAGAGGG - Intronic
1049298573 8:141856764-141856786 CAGACTGAGGACAAGAGGTGGGG + Intergenic
1049396085 8:142401609-142401631 CAGACTCAGGGGAAGTGTCCAGG + Intronic
1053069837 9:35094812-35094834 GAGACAGAGGAGAAGGGATCTGG - Intronic
1053719378 9:40929931-40929953 CAGACCTAGTAGCAGTGTTCTGG - Intergenic
1054751945 9:68916305-68916327 CAGACGGAAGAGCAGTGTTCAGG - Intronic
1055839444 9:80484541-80484563 CAGCCTGAGAAGGAGTGTCCAGG + Intergenic
1056972143 9:91214541-91214563 CATAATTAGGAGAATTGTTCAGG - Intronic
1057748678 9:97772512-97772534 CAGAGTGAGGACATGTGTTGTGG - Intergenic
1060665356 9:125429350-125429372 CACACTGGGAGGAAGTGTTCGGG + Intergenic
1188984293 X:36755596-36755618 CAGACTAAGGAGAAAAGTTGTGG - Intergenic
1189587491 X:42475357-42475379 CAGAGTGAGGTGAAATATTCTGG + Intergenic
1191731815 X:64344313-64344335 CAGACTGAGCAGATGAGATCTGG + Intronic
1195064487 X:101228072-101228094 CATACTGTGGACAAGTGTGCTGG + Intronic
1196462321 X:115943704-115943726 CATACTGAGGAGAAATGTGGGGG - Intergenic
1196500204 X:116372087-116372109 CAAACTAAAGAGAAGTGTTTGGG + Intergenic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic