ID: 996077008

View in Genome Browser
Species Human (GRCh38)
Location 5:119207967-119207989
Sequence TGGGAATCCTTTGGTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996077005_996077008 -8 Left 996077005 5:119207952-119207974 CCTTATTCTTTCCAATGGGAATC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG No data
996077004_996077008 -7 Left 996077004 5:119207951-119207973 CCCTTATTCTTTCCAATGGGAAT 0: 1
1: 0
2: 4
3: 35
4: 256
Right 996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG No data
996077003_996077008 -6 Left 996077003 5:119207950-119207972 CCCCTTATTCTTTCCAATGGGAA 0: 1
1: 0
2: 1
3: 20
4: 260
Right 996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996077008 Original CRISPR TGGGAATCCTTTGGTAAAAT AGG Intronic
No off target data available for this crispr