ID: 996077342

View in Genome Browser
Species Human (GRCh38)
Location 5:119212172-119212194
Sequence GCGGGCACAAAGTTTCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 1, 2: 15, 3: 110, 4: 605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996077342_996077345 3 Left 996077342 5:119212172-119212194 CCAAACTGAAACTTTGTGCCCGC 0: 1
1: 1
2: 15
3: 110
4: 605
Right 996077345 5:119212198-119212220 ACAACAGCTCCCCATTCCTCTGG 0: 1
1: 0
2: 3
3: 23
4: 183
996077342_996077349 16 Left 996077342 5:119212172-119212194 CCAAACTGAAACTTTGTGCCCGC 0: 1
1: 1
2: 15
3: 110
4: 605
Right 996077349 5:119212211-119212233 ATTCCTCTGGCGCCCACTCCAGG 0: 1
1: 0
2: 5
3: 25
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996077342 Original CRISPR GCGGGCACAAAGTTTCAGTT TGG (reversed) Intronic
900274328 1:1814035-1814057 GAGGGTACAGAGTTTTAGTTAGG - Intronic
900456792 1:2778873-2778895 ACGGGGACAGAGTTTCAGTTTGG - Intronic
901128195 1:6943986-6944008 ACAGGAACAGAGTTTCAGTTTGG - Intronic
901136311 1:6999036-6999058 GTGGGCACAGAGTTTCAGTTTGG - Intronic
901162365 1:7188432-7188454 ATGGGTACAGAGTTTCAGTTTGG - Intronic
901450623 1:9334626-9334648 ATGGGCACAGAGTTTCCGTTGGG - Intronic
901683823 1:10932290-10932312 ACGGGTGCAGAGTTTCAGTTGGG + Intergenic
902853584 1:19181921-19181943 GTGGGTACAGTGTTTCAGTTTGG - Intronic
903532781 1:24044632-24044654 ACGGGCATAGAGTTTCTGTTTGG - Intergenic
904112536 1:28137599-28137621 ATGGGTACAAAGTTTCAATTTGG - Intergenic
904323764 1:29713753-29713775 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
904451312 1:30614408-30614430 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
904478697 1:30780882-30780904 ATGGGCACAGAGTTTGAGTTTGG + Intergenic
904631356 1:31844916-31844938 ATGGGTACACAGTTTCAGTTGGG - Intergenic
904991236 1:34594560-34594582 AAGGGTACAAAGTTTCATTTAGG - Intergenic
905248908 1:36635543-36635565 GCGCGCACATTCTTTCAGTTGGG + Intergenic
906652577 1:47523348-47523370 AAGGGTACAAAGTTTCGGTTGGG - Intergenic
907177873 1:52542217-52542239 ACGGGTACAGAGTTTCAGCTTGG + Intronic
907653297 1:56317225-56317247 ATGGATACAAAGTTTCAGTTTGG + Intergenic
907655949 1:56342017-56342039 GTGGGCACAAAGTTACAATTAGG + Intergenic
908345732 1:63230419-63230441 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
908580158 1:65506890-65506912 GCTGATACGAAGTTTCAGTTAGG - Intronic
908648276 1:66303548-66303570 AAGGGTACAAAGTTTCTGTTAGG - Intronic
909198456 1:72657650-72657672 AAGGGCACATAGTTTCAGTTAGG - Intergenic
909242604 1:73234293-73234315 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
909381207 1:75000735-75000757 GTGGACACAAAGTTTCTCTTTGG - Intergenic
910103766 1:83607771-83607793 AAGGGTACAAAATTTCAGTTAGG + Intergenic
910316439 1:85889867-85889889 ATGGGTACAGAGTTTCAGTTTGG - Intronic
910329367 1:86052602-86052624 TTGGGTACAGAGTTTCAGTTTGG + Intronic
911126510 1:94345488-94345510 ACGGGCACAGAGCTTCTGTTTGG + Intergenic
911130625 1:94383804-94383826 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
911345193 1:96688449-96688471 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
911659095 1:100480109-100480131 ATGGGTACAAAGTTTCTGTTTGG - Intronic
911786678 1:101959004-101959026 AAGGGTACAAAGTTTTAGTTAGG - Intronic
912095474 1:106136997-106137019 GTGGGCAGAAAGCTTCAGTATGG + Intergenic
912178548 1:107190186-107190208 ATGGGCACAGAGTTTCAGTTTGG + Intronic
912190757 1:107337485-107337507 ATGAGCACAAAGTTTCAGTTAGG + Intronic
912305912 1:108566879-108566901 TAGGGCACAAAGTTTCAATTAGG + Intronic
912548651 1:110469488-110469510 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
912754863 1:112315789-112315811 AATGGTACAAAGTTTCAGTTAGG + Intergenic
914340987 1:146760311-146760333 CTGGGTACAGAGTTTCAGTTCGG + Intergenic
914723498 1:150308501-150308523 ATGGGTACAGAGTTTCAGTTTGG + Exonic
915707641 1:157861729-157861751 ATGGGCACAGAGTTTCAGTTTGG + Intronic
916204731 1:162305255-162305277 ACGGGCACAGAGTTTCTGTTTGG - Intronic
917908533 1:179614987-179615009 AAGGACACAAACTTTCAGTTAGG - Intronic
917985796 1:180317374-180317396 ATGGGTACAGAGTTTCAGTTTGG + Intronic
918452583 1:184673804-184673826 AAAGGTACAAAGTTTCAGTTAGG - Intergenic
918710951 1:187729316-187729338 ATGGGGAAAAAGTTTCAGTTTGG + Intergenic
920121549 1:203662426-203662448 ATGGGTACAGAGTTTCAGTTTGG - Intronic
920175083 1:204095788-204095810 ATGGGAACAGAGTTTCAGTTTGG - Intronic
920410066 1:205752211-205752233 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
920858069 1:209679618-209679640 AGGGGTACAAAGTTTCAATTAGG - Intergenic
920945414 1:210524113-210524135 TCGGGTATAAAGTTTCAGGTAGG + Intronic
922295000 1:224242172-224242194 ATGGGGACAGAGTTTCAGTTTGG + Intronic
922337323 1:224628400-224628422 ATGGGCACAGAGTTTCTGTTTGG - Intronic
922364190 1:224848729-224848751 AAAGGTACAAAGTTTCAGTTAGG + Intergenic
922562079 1:226576693-226576715 ATGGGCACAGAGTTTCCGTTTGG - Intronic
922779734 1:228241922-228241944 AAGTGTACAAAGTTTCAGTTTGG + Intronic
923090141 1:230734415-230734437 ATGGGCACAGAATTTCAGTTGGG + Intergenic
923275402 1:232391136-232391158 GTGGGTCCAGAGTTTCAGTTTGG - Intergenic
923652697 1:235888897-235888919 GTGGGTACAAAGTTTCCGTTTGG + Intergenic
924045025 1:240020187-240020209 GTGGGCACAGAATTTCACTTTGG - Intronic
924422521 1:243923052-243923074 GTGGGTGCAGAGTTTCAGTTTGG - Intergenic
924545493 1:245022864-245022886 ATGGGTACAGAGTTTCAGTTTGG - Intronic
924717037 1:246585239-246585261 GCTGGCAGAAAGCTTCAGTTTGG - Intronic
1062854840 10:774810-774832 GCGGCGGCAAAGTTTCTGTTTGG - Intergenic
1062949018 10:1482542-1482564 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1063142268 10:3265737-3265759 GTGGACACAGGGTTTCAGTTTGG + Intergenic
1063477236 10:6339961-6339983 CTGGGGACAGAGTTTCAGTTTGG + Intergenic
1063521568 10:6746193-6746215 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1063618729 10:7625379-7625401 ATGGGTACAAAGTTTCAGTTTGG + Intronic
1064476234 10:15691731-15691753 AAAGGTACAAAGTTTCAGTTGGG + Intronic
1064634685 10:17351913-17351935 AAGGGTACAAAGTTTCAGTTGGG + Intronic
1064667017 10:17664384-17664406 ATGGGCACAGGGTTTCAGTTTGG - Intronic
1065884449 10:30064624-30064646 ATGGGTACAAAGTTTCATTTAGG - Intronic
1066391342 10:34979553-34979575 GCGGGCACAGGGGTTCAGCTGGG + Intergenic
1066396027 10:35022661-35022683 AAGGGGACAAAGTTTCAGTTAGG + Intronic
1066453508 10:35552384-35552406 ACGGGTATAGAGTTTCAGTTTGG + Intronic
1066456826 10:35579536-35579558 ATGGGTACAAAGTTTCACTTAGG + Intergenic
1067546770 10:47197456-47197478 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1067856867 10:49801929-49801951 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1068458785 10:57298349-57298371 GTGGTCACAAACTTTCACTTTGG - Intergenic
1068806998 10:61207775-61207797 GAGGGTACAAAGTTTCAGTTAGG + Intergenic
1068984317 10:63093050-63093072 GTGGATACAAAATTTCAGTTAGG - Intergenic
1069147521 10:64914044-64914066 AAGGGTACAATGTTTCAGTTAGG - Intergenic
1069444389 10:68459626-68459648 AAGGGCACAAAGCTTCAGTTTGG + Intronic
1069495855 10:68902583-68902605 ATGGGCACAGAGTTTCAGTCTGG - Intronic
1070073512 10:73112745-73112767 AAGTGTACAAAGTTTCAGTTAGG - Intronic
1070574061 10:77664100-77664122 ATGGGCACATAGTTTCAGTTTGG - Intergenic
1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG + Intronic
1071483832 10:86084902-86084924 ATGGGTACAAAGTTGCAGTTTGG + Intronic
1071512991 10:86277088-86277110 ACAGGTACAGAGTTTCAGTTTGG + Intronic
1071529761 10:86380171-86380193 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1071844932 10:89512177-89512199 ATGGGCACAGAGTTTCAGTATGG + Intronic
1072136501 10:92551730-92551752 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1073316743 10:102586821-102586843 GTGGGTACAGAGTTTAAGTTGGG - Intronic
1073564984 10:104527306-104527328 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1073707130 10:105997595-105997617 AAGGACACAAAGTTTCAGTTGGG - Intergenic
1075287516 10:121200214-121200236 GTGCTCAAAAAGTTTCAGTTTGG + Intergenic
1075327363 10:121544694-121544716 ATGGGTACAAAGTTTCTGTTTGG + Intronic
1075535352 10:123266947-123266969 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1076064025 10:127434537-127434559 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1077656051 11:4019903-4019925 GTGGGTACAAATTTACAGTTGGG - Intronic
1078612751 11:12835866-12835888 ACGGGTACAAAGTTTCAGTTAGG + Intronic
1079982717 11:27168249-27168271 ATGGGTACAAAGTTTAAGTTAGG - Intergenic
1080570940 11:33556743-33556765 GTGGGTACAGAGTTTCTGTTTGG + Intronic
1080719470 11:34835360-34835382 AGGGGCACAGACTTTCAGTTTGG + Intergenic
1081052545 11:38362536-38362558 ATGGGAACAATGTTTCAGTTTGG - Intergenic
1081187096 11:40057061-40057083 AGGGATACAAAGTTTCAGTTAGG + Intergenic
1081624197 11:44637664-44637686 ATGGGTACAAAGTTACAGTTAGG + Intergenic
1081803389 11:45875285-45875307 GAGGACACAAGGTTACAGTTGGG + Intronic
1082892003 11:58149583-58149605 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1083327971 11:61883170-61883192 ATGGGGACAGAGTTTCAGTTGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1084281539 11:68098527-68098549 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1084677447 11:70644287-70644309 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1084724639 11:70933391-70933413 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1084763010 11:71285942-71285964 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1085753541 11:79184745-79184767 ATGGGCATAGAGTTTCAGTTTGG + Intronic
1085802664 11:79604788-79604810 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1085853340 11:80147383-80147405 GCTGGCACAACTTTTCAGCTGGG + Intergenic
1086964447 11:93013257-93013279 GATGGTACAAAGTTACAGTTGGG - Intergenic
1087427081 11:98003081-98003103 GTGGGTACACAGTTTCAATTAGG + Intergenic
1087709331 11:101530972-101530994 AAGGGTACAAACTTTCAGTTTGG + Intronic
1088187368 11:107186567-107186589 AAGGGCACAAAATTTCAGTTAGG - Intergenic
1088377262 11:109155517-109155539 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1088430275 11:109751104-109751126 ATGGGTACAAAATTTCAGTTTGG + Intergenic
1088497851 11:110449957-110449979 AAGGCTACAAAGTTTCAGTTAGG - Intronic
1088791995 11:113234407-113234429 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1088898651 11:114097330-114097352 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1089008849 11:115115871-115115893 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1090492187 11:127174487-127174509 ATGGGCACAGGGTTTCAGTTTGG - Intergenic
1090718882 11:129454729-129454751 AAGGGTACAAAATTTCAGTTAGG - Intergenic
1090884512 11:130864037-130864059 AAGGACACAAAATTTCAGTTAGG + Intergenic
1091164550 11:133463274-133463296 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1091568980 12:1668033-1668055 ATGGGGACAGAGTTTCAGTTGGG + Intergenic
1091983819 12:4890771-4890793 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1092611076 12:10173990-10174012 GTGGGTATAGAGTTTCAGTTGGG - Intronic
1093156274 12:15689742-15689764 ATGGGTACACAGTTTCAGTTAGG - Intronic
1093298212 12:17417638-17417660 ACGGGTACAAAGTTGCAGTTAGG - Intergenic
1094139391 12:27165248-27165270 AGTGGTACAAAGTTTCAGTTAGG - Intergenic
1094209998 12:27879025-27879047 AAGGACACAAAATTTCAGTTAGG - Intergenic
1095406970 12:41877417-41877439 ACGGATACAAAATTTCAGTTAGG + Intergenic
1095622639 12:44276515-44276537 AAGGACAAAAAGTTTCAGTTAGG + Intronic
1096014669 12:48258775-48258797 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1096052302 12:48621305-48621327 AAGGGTACAAAGTTTCAGGTAGG + Intergenic
1096442264 12:51653297-51653319 GTTGGTACAGAGTTTCAGTTTGG - Intronic
1096752859 12:53773603-53773625 ATGGGCACAGAGTTTTAGTTGGG + Intergenic
1097158757 12:57030780-57030802 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1097593950 12:61604455-61604477 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1098238047 12:68437609-68437631 ATGAGCACAGAGTTTCAGTTGGG + Intergenic
1098518583 12:71408650-71408672 AAGGGTACAAAGCTTCAGTTAGG + Intronic
1099256135 12:80315110-80315132 AAGGGCACAAAGTTTCAGCTAGG + Intronic
1099789060 12:87307215-87307237 GAGGGCACAAAATTTCATTTAGG - Intergenic
1100476224 12:94938152-94938174 ATGGGCACAGTGTTTCAGTTTGG + Intronic
1100625708 12:96329165-96329187 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1102138895 12:110598231-110598253 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1102796102 12:115690041-115690063 GCAGGTACAAAATTTCAGTTTGG + Intergenic
1104235794 12:126935266-126935288 GGGGGTACAAAGTTTCACTGCGG + Intergenic
1104412861 12:128573727-128573749 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1104742270 12:131186963-131186985 ATAGGCACAAAGTTACAGTTAGG + Intergenic
1105822853 13:24095443-24095465 ACGGGTACAGAGTTTTAGTTAGG + Intronic
1106014593 13:25856709-25856731 ATGAGCACAGAGTTTCAGTTTGG - Intronic
1106200234 13:27530229-27530251 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
1106357678 13:28999726-28999748 ATGGGTACAAAGTTACAGTTAGG - Intronic
1106397149 13:29392183-29392205 ATAGGTACAAAGTTTCAGTTTGG - Intronic
1106702178 13:32241525-32241547 GTGGGTACAGAATTTCAGTTTGG + Intronic
1106890235 13:34236986-34237008 AAGGGTACAAAATTTCAGTTAGG - Intergenic
1107365962 13:39676133-39676155 ACGAGTACAAAGTTACAGTTAGG - Intronic
1108108656 13:47042966-47042988 AGGGGCATAAAGTTTCAGTTAGG + Intergenic
1108175596 13:47789604-47789626 ATGGGTACAAAGTTTCACTTAGG + Intergenic
1108522222 13:51256808-51256830 GTGGGTACAGACTTTCAGTTTGG - Intronic
1108567387 13:51713983-51714005 GTGGGTAAAGAGTTTCAGTTTGG + Intronic
1108575995 13:51791717-51791739 AAGGGCACAAAGTTTCAGTTAGG - Intronic
1108728798 13:53210472-53210494 AAGGGTACAAAGTTTCAGTGAGG + Intergenic
1109395153 13:61747092-61747114 AAGGGTACAATGTTTCAGTTAGG + Intergenic
1109399158 13:61802199-61802221 GGGAACATAAAGTTTCAGTTAGG + Intergenic
1110188991 13:72707848-72707870 ACAGGTACAGAGTTTCAGTTTGG + Intergenic
1110781336 13:79469051-79469073 ATGGGTACACAGTTTCAGTTTGG + Intergenic
1112022422 13:95383283-95383305 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1112023052 13:95388475-95388497 ACAGGTACAGAGTTTCAGTTTGG - Intergenic
1112106848 13:96249963-96249985 GTGGGTACCAAGTTTAAGTTTGG + Intronic
1112312556 13:98332190-98332212 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1112346414 13:98593711-98593733 ATGGGCACAAAGTTTCAGTTTGG - Intergenic
1112441846 13:99430094-99430116 GTGGGTACAGAGTTTCTGTTTGG - Intergenic
1112526137 13:100149423-100149445 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1112648698 13:101366880-101366902 AAGGGTACAAAGTTTCAGCTAGG - Intronic
1113499636 13:110763291-110763313 ATGGGCACAGAGTTTCACTTTGG - Intergenic
1113736516 13:112682439-112682461 ATAGGCACAGAGTTTCAGTTTGG - Intronic
1113764332 13:112871457-112871479 GCGGGCAGCAAGTTGCAGATAGG + Intronic
1114695760 14:24626037-24626059 AAGAGTACAAAGTTTCAGTTAGG + Intergenic
1115280123 14:31652321-31652343 AAGGACACAAAGTTTCAGTTAGG + Intronic
1115632316 14:35257320-35257342 ACGGATACAGAGTTTCAGTTTGG - Intronic
1116380081 14:44256305-44256327 ATAGGTACAAAGTTTCAGTTAGG + Intergenic
1116399986 14:44494892-44494914 AAAGGTACAAAGTTTCAGTTAGG - Intergenic
1116830720 14:49716833-49716855 ATGGGCACAGAGTTTCTGTTTGG - Intronic
1117127963 14:52651896-52651918 ATGGGTACAAAGTTTCAGTTAGG - Intronic
1117612377 14:57498149-57498171 ATGGGTACAAAGTTACAGTTAGG - Intergenic
1117890707 14:60418828-60418850 AAGGGTAAAAAGTTTCAGTTAGG + Intronic
1117895998 14:60487232-60487254 AAGGGTACGAAGTTTCAGTTAGG - Intronic
1118287412 14:64488775-64488797 ATGGGTACAAAGTTTCTGTTTGG + Intronic
1118613620 14:67560487-67560509 GCAGGTACAGAGTTTCTGTTTGG - Intronic
1118733626 14:68686726-68686748 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1118885434 14:69861827-69861849 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1119279660 14:73394652-73394674 AAGGGTACAAAGTTTCGGTTAGG - Intronic
1119562559 14:75602699-75602721 ACGGGTACAGAGTTTCAGATTGG + Intronic
1120014078 14:79450313-79450335 AAGGGTACAAAATTTCAGTTAGG + Intronic
1120161582 14:81151357-81151379 AAGGGTACAAAGTTTCAGCTAGG - Intergenic
1121086556 14:91150921-91150943 ATGGGCAGAGAGTTTCAGTTTGG - Intronic
1121230937 14:92357712-92357734 ATGGGCACAGAGTTTCGGTTTGG + Intronic
1121800727 14:96772004-96772026 ACGGGTACAGAGCTTCAGTTTGG + Intergenic
1122158445 14:99765343-99765365 GTGGGCACAGAGTTTCCGCTTGG - Intronic
1124012002 15:25846179-25846201 ACGGGCACAAAGTTTCCGTTTGG + Intronic
1124095825 15:26648108-26648130 ATGGGCACAGAGTTCCAGTTGGG - Intronic
1124154387 15:27212690-27212712 GTGAGTACAAAGTTTCAGTGTGG - Intronic
1124372764 15:29112821-29112843 GTGGGGACAAAGTTCCTGTTGGG - Intronic
1124385484 15:29204943-29204965 GTGGTGACAGAGTTTCAGTTTGG - Intronic
1124705674 15:31961973-31961995 GCTGGCTCAAAGCTACAGTTTGG + Intergenic
1124798290 15:32804143-32804165 AAGGGTATAAAGTTTCAGTTGGG + Intronic
1124945311 15:34259964-34259986 CAGGATACAAAGTTTCAGTTAGG + Intronic
1125035856 15:35122625-35122647 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1125396525 15:39254570-39254592 ACGGATACAAAGTTTCAGTTAGG + Exonic
1125553223 15:40563538-40563560 ATGGGTACACAGTTTCAGTTTGG + Intronic
1126226380 15:46274989-46275011 AGAGGCACAAAGTTACAGTTAGG + Intergenic
1126502455 15:49361049-49361071 AAGAGGACAAAGTTTCAGTTAGG + Intronic
1127312393 15:57764094-57764116 ATGGGTACATAGTTTCAGTTTGG - Intronic
1127695829 15:61446279-61446301 ATGGATACAAAGTTTCAGTTTGG + Intergenic
1128239129 15:66088863-66088885 GTGAGGACAGAGTTTCAGTTGGG + Intronic
1128460442 15:67862970-67862992 TCAGCCACAAAATTTCAGTTGGG + Intergenic
1128466129 15:67913889-67913911 GTGGGTATAGAGTTTCAGTTTGG + Intergenic
1128473339 15:67975114-67975136 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1128585426 15:68845327-68845349 ATGGGCACAAAGTTTCAGTTTGG - Intronic
1129517736 15:76166811-76166833 GCGGGTACAGAGTTTCAGTTTGG + Intronic
1129767502 15:78179487-78179509 GCGGGCACAAAGTACCAGCAAGG + Intronic
1130084028 15:80762262-80762284 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
1131906699 15:97150352-97150374 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1132057980 15:98666770-98666792 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1132154758 15:99487484-99487506 GTGGGGACAGAGTTTCAGTTTGG + Intergenic
1133253325 16:4499543-4499565 AAGGGTACAAAATTTCAGTTAGG + Intronic
1133486942 16:6228681-6228703 TCGGGTACAAAATTTCAGGTAGG + Intronic
1133843941 16:9436947-9436969 AAGGACACAAAATTTCAGTTAGG + Intergenic
1133946389 16:10352479-10352501 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1134088384 16:11374450-11374472 ATGGGGATAAAGTTTCAGTTTGG - Intronic
1134911742 16:18033329-18033351 GTGGGAACAGAGTTTCAATTTGG - Intergenic
1135357165 16:21778994-21779016 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135455669 16:22595110-22595132 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135459748 16:22631405-22631427 AAGGGTACAAAGCTTCAGTTAGG - Intergenic
1135866735 16:26110001-26110023 ATGGGTACAAAGTTTCACTTAGG - Intronic
1136279487 16:29199640-29199662 GTGGGGACACAGTTTCAGTTTGG - Intergenic
1136858859 16:33683074-33683096 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1136931572 16:34422441-34422463 ACGGGCACGGAGTTTCTGTTTGG + Intergenic
1136973000 16:34989378-34989400 ACGGGCACGGAGTTTCTGTTTGG - Intergenic
1137295376 16:47087470-47087492 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1137390542 16:48077614-48077636 GTGGGCACAGAGTTTCAGTTTGG + Intergenic
1137739378 16:50752634-50752656 ACAGGCACAGAGTTTCGGTTTGG - Intronic
1138478639 16:57286829-57286851 ACAGGTACAAAGTTACAGTTAGG - Intergenic
1139766697 16:69236519-69236541 GTGGGTATAGAGTTTCAGTTTGG + Intronic
1139935298 16:70566175-70566197 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1139993298 16:70957095-70957117 ATGGGTACAGAGTTTCAGTTCGG - Intronic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1140668678 16:77252335-77252357 CAAGGTACAAAGTTTCAGTTAGG - Intronic
1141332236 16:83121622-83121644 GCAGGGACAAAGTTACATTTGGG - Intronic
1141729905 16:85815157-85815179 GTGGGGACAGAGTTTCAGTTTGG - Intergenic
1142083878 16:88165741-88165763 GTGGGGACACAGTTTCAGTGTGG - Intergenic
1203120433 16_KI270728v1_random:1531568-1531590 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1142929717 17:3272760-3272782 AAGGGCACAAAGTTTCAATTAGG + Intergenic
1143087277 17:4425572-4425594 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
1143607682 17:7998969-7998991 ATGGGCACAGAGTTTCAATTGGG + Intergenic
1143673869 17:8416148-8416170 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1144132599 17:12261052-12261074 CTGGGCACAGAGTTTCAGTTTGG - Intergenic
1144525568 17:15986697-15986719 AAGGGTACAAAATTTCAGTTAGG + Intronic
1145065854 17:19760776-19760798 ATGGACACAGAGTTTCAGTTTGG - Intergenic
1148636922 17:49156130-49156152 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1149676715 17:58471090-58471112 GCAGGTACAGAGTTTCGGTTGGG + Intronic
1149786009 17:59435800-59435822 ACGGGTACAGAGTTTCCGTTTGG - Intergenic
1150053432 17:61988921-61988943 GGGGACACAAAATTTCAGTTGGG - Intronic
1150353217 17:64461731-64461753 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1150474208 17:65462066-65462088 ATGGGCACAAAGGATCAGTTTGG - Intergenic
1152385628 17:79972678-79972700 ACGGGAACAGAGTTTCGGTTGGG + Intronic
1152682599 17:81676852-81676874 GCTGGCACACAGTGTCAATTGGG - Intergenic
1152913534 17:83019554-83019576 ACGGGGACAGAGCTTCAGTTCGG + Intronic
1153124234 18:1770724-1770746 GCAGGTACACAGTCTCAGTTTGG - Intergenic
1153771830 18:8422895-8422917 ACGGGTACAGAGTTTCACTTTGG + Intergenic
1153836027 18:8964878-8964900 ATGAGCACAAAGTTTCAGTTTGG + Intergenic
1153903159 18:9636898-9636920 ACGGGTACAGAGCTTCAGTTGGG + Intergenic
1154131638 18:11741988-11742010 ACGGGTACAGAGATTCAGTTTGG - Intronic
1154138658 18:11803197-11803219 ATGAGCACAAAGTTTCATTTTGG - Intronic
1154976802 18:21465210-21465232 AAGGACACAAAATTTCAGTTAGG - Intronic
1155296712 18:24391316-24391338 ACAGGAACAGAGTTTCAGTTTGG + Intronic
1155468152 18:26162268-26162290 AAGGGTACAAAGTTTCAGTCAGG - Intronic
1155770297 18:29689469-29689491 AAGGACACAAAGTTTTAGTTAGG + Intergenic
1156138227 18:34070986-34071008 ATGGGTACAAAGTTACAGTTAGG + Intronic
1156224801 18:35093801-35093823 GTGGGTACAAAGTTACAGTTAGG + Intronic
1156323437 18:36050107-36050129 ATGGATACAAAGTTTCAGTTTGG + Intronic
1156423078 18:36977598-36977620 GGTGGCACACAGTTCCAGTTGGG - Intronic
1157390404 18:47297571-47297593 ACGTGTACAAAGTTTCTGTTTGG - Intergenic
1157556241 18:48614708-48614730 GTGGGCACAGAGTTTCTGTTTGG + Intronic
1157606836 18:48931187-48931209 ATGGGAACAAAGTTTCAGCTAGG + Intronic
1157618067 18:48999257-48999279 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1158119404 18:54031509-54031531 ATGGGCACAGAGTCTCAGTTTGG + Intergenic
1158266904 18:55669280-55669302 AAGGGTACCAAGTTTCAGTTGGG + Intergenic
1158425402 18:57335532-57335554 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1158585938 18:58735016-58735038 CAGGGTACAATGTTTCAGTTAGG - Intronic
1158672374 18:59488215-59488237 ACGGATACAGAGTTTCAGTTTGG + Intronic
1158902512 18:61979038-61979060 GTGGGCTCATAGTTTCTGTTTGG - Intergenic
1159006148 18:63014521-63014543 ACGGATACAGAGTTTCAGTTTGG - Intergenic
1160624479 18:80193511-80193533 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1160807362 19:998267-998289 CTGGGGACAGAGTTTCAGTTTGG + Intronic
1161128572 19:2574347-2574369 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161245711 19:3250594-3250616 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161276207 19:3419102-3419124 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161360161 19:3844063-3844085 ACGGGGACAGAGCTTCAGTTTGG + Intronic
1161556597 19:4946147-4946169 GTGGAGACAACGTTTCAGTTTGG - Intronic
1161634905 19:5381852-5381874 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161749492 19:6084483-6084505 ATGGGGACAAAGTTTCAATTTGG - Intronic
1161787898 19:6339487-6339509 TTGGGGACAGAGTTTCAGTTTGG + Intergenic
1161920610 19:7262872-7262894 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161931465 19:7343364-7343386 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161987840 19:7667142-7667164 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162124597 19:8492631-8492653 ATGGGTACAAAGTTACAGTTAGG + Intronic
1162133037 19:8538877-8538899 CTGGGGACACAGTTTCAGTTTGG + Intronic
1162330164 19:10023221-10023243 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162862994 19:13522104-13522126 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1163165944 19:15498342-15498364 ACGGGGACAGAGTTTCAGCTGGG - Intronic
1163283921 19:16334387-16334409 ATGGGATCAAAGTTTCAGTTTGG - Intergenic
1165220511 19:34312411-34312433 GCAGGTACAGAGTTTCAGTTTGG - Intronic
1165598618 19:37033325-37033347 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1166342052 19:42143988-42144010 GCTGGCATAAACATTCAGTTTGG - Intronic
1167174362 19:47855209-47855231 ATAGGTACAAAGTTTCAGTTTGG - Intergenic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
1167764554 19:51472703-51472725 GTGGGTACAGAGTTTCAATTTGG - Intergenic
1168443552 19:56392318-56392340 GCATGCACAAAGCCTCAGTTTGG - Intronic
1168500701 19:56890480-56890502 GTGGGGACAGAGTTTCAGTTGGG - Intergenic
925211644 2:2053282-2053304 ACGGGGACAGGGTTTCAGTTAGG + Intronic
925282922 2:2697308-2697330 AAGGGAACAAAGTTTCAGATGGG - Intergenic
926640292 2:15228852-15228874 ATAGGCACAAAGTTACAGTTGGG + Intronic
926722902 2:15975335-15975357 ATGGGTACAAAGTTTCAATTTGG + Intergenic
927258852 2:21065689-21065711 ACAGGCACAAAGTCTCAGTAAGG + Intergenic
927714993 2:25346018-25346040 ACGGGGATAGAGTTTCAGTTTGG + Intergenic
927750841 2:25669143-25669165 AGGGGTACAGAGTTTCAGTTGGG + Intronic
928183412 2:29087397-29087419 AAGGGTACAAAGTTTCACTTAGG - Intergenic
928232126 2:29507400-29507422 TTGGGTACACAGTTTCAGTTTGG + Intronic
928338420 2:30418987-30419009 AAGGACACAAAATTTCAGTTAGG + Intergenic
928596059 2:32860242-32860264 AAGGATACAAAGTTTCAGTTAGG - Intergenic
929239675 2:39641119-39641141 AAGGGTATAAAGTTTCAGTTAGG - Intergenic
930284078 2:49406073-49406095 GCAGGTACAAAGATACAGTTAGG - Intergenic
930382738 2:50652355-50652377 ATGGGCACAAAGTTTCTTTTTGG - Intronic
932200514 2:69822790-69822812 GTGGGTACAGAGTTTCTGTTTGG + Intronic
932746738 2:74340062-74340084 ATGGGTATAAAGTTTCAGTTGGG + Intronic
932804923 2:74775194-74775216 ATGGGTACAAAGTTTCTGTTTGG + Intergenic
932833874 2:75016589-75016611 AAGGGTACAAAGTTTTAGTTAGG + Intergenic
932843284 2:75105406-75105428 AAGGGCACAAAGTGTCACTTAGG + Intronic
933377331 2:81496598-81496620 GTGTGCACCAAGTTTCATTTGGG + Intergenic
934705189 2:96472374-96472396 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
934898138 2:98136338-98136360 ATGGGCACAGGGTTTCAGTTTGG - Intronic
935073092 2:99713106-99713128 ATGGGCACAGAGTTTCAGTTTGG + Intronic
935186807 2:100742032-100742054 ATGGGTATAAAGTTTCAGTTAGG + Intergenic
935252727 2:101278773-101278795 AAAGGTACAAAGTTTCAGTTAGG - Intronic
935864439 2:107370214-107370236 ACAGGTACAAAGTTACAGTTAGG - Intergenic
935972003 2:108538833-108538855 CTGGTCACAGAGTTTCAGTTTGG - Intronic
935985450 2:108668323-108668345 ATGGGTACAAAGTTACAGTTAGG - Intronic
936696700 2:114958413-114958435 ACGGGTACAAAGTTTCAGCTGGG + Intronic
936988454 2:118335336-118335358 GAGGGCACAAAGCTTCAGTTAGG - Intergenic
937302142 2:120849206-120849228 ATGTGCACAGAGTTTCAGTTTGG + Intronic
937895239 2:126972793-126972815 GTGGGTGCAGAGTTTCAGTTTGG - Intergenic
938166437 2:129031411-129031433 ATGGGCACAAAGTTTAGGTTTGG + Intergenic
940197321 2:151109691-151109713 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
940212743 2:151272959-151272981 ATGGGTACAGAGTTTCAGTTTGG + Intronic
940801932 2:158142752-158142774 ATGAGCACAGAGTTTCAGTTTGG + Intergenic
940981577 2:160009556-160009578 ATGGGTACAGAGTTTCAGTTTGG + Intronic
941105093 2:161343183-161343205 ATGGGTACAGAGTTTCAGTTTGG - Intronic
941118407 2:161498926-161498948 AGGGGTACTAAGTTTCAGTTAGG - Intronic
941207928 2:162597580-162597602 AAGGGTGCAAAGTTTCAGTTAGG + Intronic
941680711 2:168395741-168395763 ACGGGTGCAAAGCTTCAGTTTGG - Intergenic
941820000 2:169835044-169835066 ACAGGTACAGAGTTTCAGTTTGG + Intronic
942148983 2:173056215-173056237 ATGGGCACAGAATTTCAGTTTGG - Intergenic
942617492 2:177809133-177809155 ATGGGTACAGAGTTTCAGTTTGG + Intronic
942658550 2:178240158-178240180 ACGGGTACATAGTTTTAGTTTGG + Intronic
942756984 2:179352793-179352815 AAGGGTACAAAGTTTCAGCTGGG - Intergenic
942762762 2:179419226-179419248 AAGGACACAAAATTTCAGTTAGG + Intergenic
943050637 2:182909316-182909338 AAGGGAACAGAGTTTCAGTTGGG - Intronic
943964404 2:194314231-194314253 ATGGGCATAAAGTTTCAGTTGGG - Intergenic
944230752 2:197389589-197389611 GCAGCCACATAGGTTCAGTTTGG - Intergenic
944733392 2:202537540-202537562 ATGGGTACAGAGTTTCAGTTTGG + Intronic
944762747 2:202833945-202833967 AAGGACACAAAATTTCAGTTAGG + Intronic
944894228 2:204147606-204147628 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
945108367 2:206338800-206338822 ATGGGTACAAATTTTCAGTTAGG - Intergenic
945376700 2:209085076-209085098 GGGGTAACAGAGTTTCAGTTAGG - Intergenic
946635500 2:221720938-221720960 ACAGGTACAAAGTTACAGTTAGG - Intergenic
947890119 2:233610319-233610341 AGGGGTCCAAAGTTTCAGTTTGG - Intergenic
947891757 2:233629079-233629101 ATGGGTCCAAAGTTTCAGTTTGG - Intronic
948018172 2:234707178-234707200 AAGGGCACAAAGTTTCAGCACGG - Intergenic
948706308 2:239795571-239795593 ATGGGGACAGAGTTTCAGTTTGG - Intronic
948796471 2:240405155-240405177 GTGGGCACAAGGTTTCTTTTGGG - Intergenic
1168988025 20:2067446-2067468 ACGGGTACAGAGTTTCAGGTTGG + Intergenic
1169277133 20:4241276-4241298 ATGGGCATAAAGTTTCAGTTTGG + Intronic
1169895030 20:10494874-10494896 AGGGGTACAAAGTTTCAGTTAGG + Intronic
1169996244 20:11560242-11560264 GTGGGTACAAAATTACAGTTAGG + Intergenic
1170161073 20:13311821-13311843 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
1170650210 20:18232583-18232605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1172861927 20:38061245-38061267 ACGGGTATAGAGTTTCAGTTTGG - Intronic
1172979929 20:38933291-38933313 ATGGGCACAGAGTTTCTGTTTGG + Intronic
1173030565 20:39355196-39355218 AAGGGTACAAAGTTTCAGTTTGG + Intergenic
1174525409 20:51166571-51166593 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1174894351 20:54433121-54433143 AGGGATACAAAGTTTCAGTTAGG - Intergenic
1175026357 20:55906939-55906961 ACGGGCACAAGGTTTCTTTTTGG - Intergenic
1175175761 20:57110950-57110972 ACAGGGACAGAGTTTCAGTTTGG - Intergenic
1176030823 20:63010388-63010410 CTGGGGACAGAGTTTCAGTTTGG - Intergenic
1176362953 21:6013738-6013760 ACGGGTACAGAGTTTCTGTTTGG - Intergenic
1177512411 21:22106306-22106328 AAGAGCACAAAGTTTCAGTTAGG - Intergenic
1178243891 21:30934066-30934088 ACAGGTACAAAGTTACAGTTAGG + Intergenic
1178756378 21:35354090-35354112 ATGGGGACAAAGTTTCTGTTTGG - Intronic
1178758397 21:35375958-35375980 AAGGGCATAAAGTTGCAGTTAGG - Intronic
1178974800 21:37212363-37212385 AAGGGTAAAAAGTTTCAGTTAGG - Intergenic
1179520191 21:41938515-41938537 GTGAGGACAGAGTTTCAGTTTGG - Intronic
1179760565 21:43524807-43524829 ACGGGTACAGAGTTTCTGTTTGG + Intergenic
1179789087 21:43745495-43745517 GTGAGGACAGAGTTTCAGTTTGG + Intronic
1179948170 21:44694438-44694460 ATGGGGACAGAGTTTCAGTTCGG + Intronic
1180677677 22:17599147-17599169 ATGAGCACAAAGTTTCAGTACGG + Intronic
1181868415 22:25877863-25877885 AACGGCACAAAGTTTCCGTTAGG - Intronic
1182822541 22:33230345-33230367 GCTGGCACAAAATTTCAGTGTGG - Intronic
1183087494 22:35495442-35495464 GCGGCCACAGAGCTTCAGTGTGG + Intergenic
1183473635 22:38023589-38023611 ATGGGCATACAGTTTCAGTTCGG - Intronic
1184016465 22:41789603-41789625 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1184267014 22:43353627-43353649 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1184518251 22:44976425-44976447 ATGGGTACAAAGTTACAGTTAGG - Intronic
949863212 3:8525154-8525176 AAGGGTACAAAGTTTCAATTAGG - Intronic
949958951 3:9295762-9295784 ATGGGTACAGAGTTTCAGTTTGG - Intronic
950527161 3:13531150-13531172 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
950881260 3:16324389-16324411 AAGGGTACAAAGTTTCAGTTAGG - Intronic
951184599 3:19698113-19698135 ACAGGCATGAAGTTTCAGTTAGG + Intergenic
952364396 3:32662105-32662127 AAGGGCACAAAGGTTCAGTCTGG + Intergenic
952773775 3:37025181-37025203 ATGGGCACAGAGTTTCAGTTTGG + Intronic
952796838 3:37246639-37246661 GTGGGTACAGAGTTTTAGTTTGG + Intronic
953123515 3:40069549-40069571 ACGGGCATAGAGCTTCAGTTTGG - Intronic
953161940 3:40428904-40428926 GCGGGAGCAAAGGTACAGTTTGG - Intergenic
953231398 3:41068225-41068247 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
953266621 3:41395648-41395670 ATAGGCACAGAGTTTCAGTTTGG + Intronic
953559992 3:43980574-43980596 ACGTGTACAGAGTTTCAGTTTGG - Intergenic
953812785 3:46129024-46129046 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
953862752 3:46558954-46558976 AAGGGTACAAAGTTTCAGATAGG + Intronic
953920981 3:46951254-46951276 AAGGACACAAAGTTCCAGTTAGG + Intronic
955462194 3:59195431-59195453 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
955765335 3:62338521-62338543 ATGGGCATAGAGTTTCAGTTTGG + Intergenic
955771424 3:62388512-62388534 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
956027585 3:64999861-64999883 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
957006812 3:74958038-74958060 ACAGGTACAAAGTTACAGTTAGG - Intergenic
957801221 3:85085173-85085195 AAGGTTACAAAGTTTCAGTTAGG - Intronic
957991460 3:87632387-87632409 GCAGGTACAAAGTTACAATTAGG + Intergenic
958993892 3:100879124-100879146 ACGGGTAGGAAGTTTCAGTTAGG - Intronic
959088208 3:101873806-101873828 GGGGGCCCAAAGATTCTGTTTGG + Intergenic
959231817 3:103664066-103664088 GTGGGTATAGAGTTTCAGTTTGG + Intergenic
959594974 3:108119886-108119908 AAGGGTACAAAGTTACAGTTAGG + Intergenic
959603560 3:108216970-108216992 GTGAGTACAAAGTTACAGTTAGG + Intronic
960109560 3:113832559-113832581 ACTGGTTCAAAGTTTCAGTTTGG - Intronic
960216130 3:115039826-115039848 AAGGGTACAAAATTTCAGTTAGG + Intronic
961576311 3:127839505-127839527 GAGGGTACAAAGTTTCAGTTAGG + Intergenic
961617107 3:128191582-128191604 ATGGGTACAGAGTTTCAGTTTGG - Intronic
961747378 3:129073152-129073174 GTGGGGACAGAGTTTCAGTTTGG + Intergenic
961945720 3:130685168-130685190 AAGAGTACAAAGTTTCAGTTAGG + Intronic
962182030 3:133216555-133216577 AAGGATACAAAGTTTCAGTTAGG - Intronic
963536587 3:146537184-146537206 CCGAGTACAAAGTTTCACTTGGG - Intronic
963570767 3:146992608-146992630 ATGGGTAAAAAGTTTCAGTTTGG - Intergenic
963823608 3:149927106-149927128 ACAGGTACAGAGTTTCAGTTTGG - Intronic
964790226 3:160446991-160447013 ATGGGTACACAGTTTCAGTTTGG + Intronic
964809296 3:160645624-160645646 ACGGGTACAGAGTTTCATTTGGG + Intergenic
965505370 3:169509465-169509487 TTGGGTACAGAGTTTCAGTTTGG - Intronic
966290962 3:178359242-178359264 AAGGGTACAAAGTTTCAGCTAGG + Intergenic
966517897 3:180839427-180839449 AAGGACACAAAATTTCAGTTAGG - Intronic
966819344 3:183912751-183912773 GTGGGTACAGAGTTTCAGTCTGG + Intergenic
966838881 3:184072098-184072120 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
967052148 3:185794782-185794804 ATGGGAACAGAGTTTCAGTTTGG - Intronic
967278145 3:187796420-187796442 GCAGGCACAGAGTTTGAGTGGGG - Intergenic
969359557 4:6653915-6653937 ATGGGGACAAAGTTTCAGTTTGG + Intergenic
969371845 4:6736541-6736563 ATGGGGACAGAGTTTCAGTTGGG - Intergenic
970176421 4:13344103-13344125 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
970569681 4:17367602-17367624 ATGGGTACAAAGCTTCAGTTTGG + Intergenic
970670495 4:18391268-18391290 ATGGGCACAAGGTTTCATTTTGG + Intergenic
971209990 4:24606959-24606981 ATGGGCACAGATTTTCAGTTTGG + Intergenic
971411382 4:26376245-26376267 ATGAGCACAGAGTTTCAGTTTGG - Intronic
972147465 4:36045574-36045596 AATGGTACAAAGTTTCAGTTAGG + Intronic
972439495 4:39072831-39072853 GTGTGCACAAAGTTACAATTAGG + Intronic
972508762 4:39747316-39747338 ATGGGTACGAAGTTTCAGTTTGG - Intronic
972544436 4:40066829-40066851 CTGGGTACAGAGTTTCAGTTTGG - Intronic
972823365 4:42728082-42728104 AAGTGTACAAAGTTTCAGTTAGG - Intergenic
973080638 4:45988002-45988024 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
973621500 4:52731037-52731059 ACAGGCACAGAGTTCCAGTTTGG - Intronic
973931665 4:55799268-55799290 GTGGGTACAGGGTTTCAGTTTGG + Intergenic
974446506 4:61990435-61990457 GTGGGTACAGAGTTTCATTTTGG + Intronic
974498352 4:62663176-62663198 AAGGTTACAAAGTTTCAGTTAGG - Intergenic
975139515 4:70905000-70905022 TGGGGCACAATTTTTCAGTTAGG + Intronic
975162080 4:71135690-71135712 AAGGGTACAAAATTTCAGTTAGG - Intergenic
976143037 4:82012907-82012929 AAGGGTACAAAGTTACAGTTAGG + Intronic
976280751 4:83324793-83324815 ATGGGTACAGAGTTTCAGTTTGG + Intronic
976384802 4:84444471-84444493 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
976503304 4:85816267-85816289 AAGGGTGCAAAGTTTCAGTTAGG - Intronic
976726406 4:88219964-88219986 ATGGGCAAGAAGTTTCAGTTTGG - Intronic
976916264 4:90379147-90379169 GCTCACACAAAGTTTCAGTTGGG + Intronic
978076341 4:104535090-104535112 GCAGGTACAAAGCTACAGTTAGG - Intergenic
978141278 4:105319979-105320001 GTGGGTACAGAGTTTCTGTTTGG + Intergenic
978435107 4:108675896-108675918 AGGAGCACAAAATTTCAGTTAGG - Intergenic
980793271 4:137647617-137647639 GATGTCACAAGGTTTCAGTTTGG - Intergenic
982253960 4:153434554-153434576 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
984004163 4:174288389-174288411 AAGGGTACAAAGTTTCAGTTAGG - Intronic
984855610 4:184193491-184193513 CAGGGCACAAAGTTTCCTTTTGG + Intronic
984897151 4:184551446-184551468 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
984926496 4:184811680-184811702 ACGGGCACAGAGTTTCAATTCGG + Intronic
984982007 4:185291323-185291345 ACGGATACGAAGTTTCAGTTTGG - Intronic
985001942 4:185494183-185494205 ATGGGCACAGAGTTTCTGTTTGG + Intergenic
985232115 4:187830298-187830320 AAGGGTACCAAGTTTCAGTTAGG - Intergenic
985243827 4:187959311-187959333 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
985307269 4:188557037-188557059 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
986771057 5:10974066-10974088 ATGGGCACAGAGTTTCTGTTTGG - Intronic
989227242 5:39043496-39043518 ATGGGTACAAAGTTACAGTTAGG + Intronic
989322549 5:40153443-40153465 GTGGGTATAAAGTTACAGTTAGG + Intergenic
989444906 5:41516102-41516124 ACAGGTACAGAGTTTCAGTTTGG + Intergenic
990930449 5:61084432-61084454 ATGGGCATGAAGTTTCAGTTTGG - Intronic
991453707 5:66780180-66780202 ATGGGTACAAAGTTTCAGTTTGG - Intronic
991518791 5:67470684-67470706 AAGGGTACAAAATTTCAGTTAGG - Intergenic
991656250 5:68906545-68906567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
993321135 5:86468389-86468411 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
993554898 5:89324185-89324207 AAGAGCACAAAGTCTCAGTTAGG - Intergenic
994088117 5:95782404-95782426 TTGGGTACAGAGTTTCAGTTTGG + Intronic
994727842 5:103457393-103457415 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
995007302 5:107215420-107215442 ATGGGTACGAAGTTTCAGTTTGG + Intergenic
995987850 5:118201613-118201635 ATGGGCACAGAGTTTCTGTTTGG + Intergenic
996072795 5:119153536-119153558 AAGGGTAAAAAGTTTCAGTTAGG - Intronic
996077342 5:119212172-119212194 GCGGGCACAAAGTTTCAGTTTGG - Intronic
996269821 5:121589815-121589837 ATGAGTACAAAGTTTCAGTTAGG + Intergenic
996350422 5:122534797-122534819 CTGGGAACAGAGTTTCAGTTGGG - Intergenic
996521646 5:124433861-124433883 ACAGGTACAAAGTTACAGTTAGG + Intergenic
996632585 5:125652252-125652274 GTGGGTACAAAGTTTCAGTTAGG + Intergenic
996698641 5:126425894-126425916 GAGGGTACGAAGTTTCAGTTAGG + Intronic
997107796 5:131041045-131041067 AAGGGCACAAAGTTTCAGTTAGG + Intergenic
997205635 5:132047545-132047567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
997547801 5:134724074-134724096 AAGGGTACAAAATTTCAGTTAGG - Intronic
998213704 5:140221334-140221356 ACAGGGACACAGTTTCAGTTTGG - Intronic
998994015 5:147850955-147850977 ATGGGTACAAAGTTACAGTTAGG - Intergenic
999695807 5:154188128-154188150 ATGGGTACAGAGTTTCAGTTGGG + Intronic
999795248 5:154982802-154982824 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1000075344 5:157779360-157779382 ACGGGTGCAGAGTTTCAGTTTGG + Intergenic
1001047454 5:168385711-168385733 ACGAGTACAGAGTTTCAGTTTGG + Intronic
1001472435 5:172024063-172024085 ATGGGCACAAAGTTTCTGTTTGG - Intergenic
1001511382 5:172325058-172325080 ATGGGCACACAGTTTCATTTTGG + Intergenic
1001908653 5:175495325-175495347 ATGGGGACAAAGTTTTAGTTGGG + Intronic
1001965898 5:175909624-175909646 AAGGACACAAAGTTCCAGTTAGG + Intergenic
1002147929 5:177200535-177200557 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1002251046 5:177929577-177929599 AAGGACACAAAGTTCCAGTTAGG - Intergenic
1002343655 5:178533318-178533340 ATGGGCACAAAGTTTCCGTGTGG - Intronic
1003090871 6:3101909-3101931 GCAGGTACAGAGTTTCAGTTTGG - Intronic
1003092673 6:3117625-3117647 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1003161759 6:3641702-3641724 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
1003295558 6:4823578-4823600 ACGGTTACAAAGTTTCTGTTTGG - Intronic
1003295569 6:4823705-4823727 CCGGTTACAAAGTTTCTGTTTGG - Intronic
1003531843 6:6943633-6943655 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1003536264 6:6978260-6978282 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1003549329 6:7088193-7088215 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1004784466 6:18951153-18951175 ACGGATACAAAGTTACAGTTAGG + Intergenic
1005320840 6:24651986-24652008 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1005589201 6:27307591-27307613 AAGGGTACAAAGTTTCAGATAGG - Intronic
1007558879 6:42789137-42789159 ATGGGCGCAGAGTTTCAGTTTGG + Intronic
1008006140 6:46411354-46411376 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1008057294 6:46958394-46958416 GTGTGTACAGAGTTTCAGTTAGG + Intergenic
1008526422 6:52412121-52412143 CCCGGCACAAAGTTTGTGTTCGG + Intergenic
1008675847 6:53817549-53817571 AAGGGTACAAAGTTTAAGTTAGG - Intronic
1010443383 6:75925007-75925029 GTGGGTACAAAGTTACAATTAGG + Intronic
1010475958 6:76287583-76287605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1010747033 6:79575244-79575266 AAGGACACAAAATTTCAGTTAGG - Intergenic
1010906008 6:81489837-81489859 AAGGGTACAAAATTTCAGTTAGG + Intergenic
1011109650 6:83822933-83822955 TCGTGCACAAATTTTCATTTGGG + Intergenic
1011471950 6:87716780-87716802 TTGGGTACAAAGTTTCAGTTAGG + Intergenic
1011659564 6:89582594-89582616 ATGGGTACAAAGTTACAGTTTGG - Intronic
1011869419 6:91873821-91873843 GCTGGTACAGAGTTTCAGTTTGG + Intergenic
1012056509 6:94419036-94419058 ACGTGTACAACGTTTCAGTTAGG - Intergenic
1013252860 6:108352076-108352098 ATGGACACAGAGTTTCAGTTTGG - Intronic
1013840950 6:114393138-114393160 GCGAGTACAAAGTTTCAGTTAGG - Intergenic
1014334054 6:120109171-120109193 AGGGGTACAAAGTTTCAGTTAGG - Intergenic
1014375220 6:120663992-120664014 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1014932086 6:127346910-127346932 GTGGGTACAAAGTTACAGTTAGG + Intergenic
1015037215 6:128670176-128670198 ATGGGTACAAAGTTTCAGTTAGG + Intergenic
1016434158 6:144018412-144018434 AAGGACACAAAGTTTCAGTAAGG + Intronic
1017200544 6:151749527-151749549 ACTGGTACAAAGTTGCAGTTAGG - Intronic
1017846953 6:158266930-158266952 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1018034368 6:159868717-159868739 ATGGGCACTAAGTTTCTGTTAGG + Intergenic
1018334123 6:162766178-162766200 ATGGGGACAAAGTTTCAGATAGG - Intronic
1018459196 6:163981316-163981338 ATGGGGACAAAGTTTCAGTTTGG + Intergenic
1018700207 6:166420371-166420393 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1019503416 7:1377118-1377140 ATGGGAACGAAGTTTCAGTTGGG + Intergenic
1019507571 7:1400297-1400319 GTGGGGACAGAGCTTCAGTTTGG - Intergenic
1019582402 7:1771934-1771956 AAGGGGACAAAGTTTCAGTTAGG - Intergenic
1019694261 7:2436256-2436278 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1019794866 7:3042165-3042187 CGGGGGACACAGTTTCAGTTTGG + Intronic
1019810351 7:3160623-3160645 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1019923318 7:4176610-4176632 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1020115565 7:5474203-5474225 ATGGGGACAGAGTTTCAGTTGGG + Intronic
1021532406 7:21662714-21662736 AAGGACACAAAATTTCAGTTGGG - Intronic
1021848638 7:24786682-24786704 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021915702 7:25430314-25430336 ATGGGTACAAAGTTTCTGTTTGG - Intergenic
1021922767 7:25503249-25503271 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1022168993 7:27804725-27804747 GTGCTCAAAAAGTTTCAGTTTGG + Intronic
1023196879 7:37650560-37650582 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1023329723 7:39101602-39101624 AAGGGTAGAAAGTTTCAGTTAGG + Intronic
1023490111 7:40730651-40730673 AAGGACACAAAATTTCAGTTAGG - Intronic
1023751129 7:43373753-43373775 GTGGGGACAGAATTTCAGTTTGG - Intronic
1023877892 7:44299403-44299425 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1024673686 7:51619249-51619271 CAGGATACAAAGTTTCAGTTAGG + Intergenic
1025201929 7:56967710-56967732 GCGTGCACACAGATTCAGATAGG + Intergenic
1025670017 7:63609218-63609240 GCGTGCACACAGATTCAGATAGG - Intergenic
1026424380 7:70275422-70275444 ATGGGCACAAGGTTTCATTTTGG + Intronic
1026667585 7:72357101-72357123 GCTGTCTCTAAGTTTCAGTTTGG - Intronic
1027460573 7:78447874-78447896 GCAAGTACAAAGTTGCAGTTCGG - Intronic
1027502137 7:78966295-78966317 ACAGGTATAAAGTTTCAGTTAGG - Intronic
1028587106 7:92463247-92463269 GTGGGTACAAATTTTCGGTTTGG + Intergenic
1028619285 7:92805950-92805972 GTGAGTACAAAATTTCAGTTTGG + Intronic
1028646209 7:93099290-93099312 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1029148025 7:98460361-98460383 ATGGGGACAAAGTTTCAGTGTGG - Intergenic
1030233918 7:107238112-107238134 AAGGGTACAAAGTTGCAGTTAGG - Intronic
1030619324 7:111772122-111772144 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1031870697 7:127087240-127087262 GAGGGGAGAAACTTTCAGTTTGG + Intronic
1032503875 7:132421056-132421078 GCAGGGACAGAGTTTTAGTTTGG - Intronic
1032537436 7:132676758-132676780 ATGGGCACAGAGTTTCAGTCTGG - Intronic
1032805162 7:135347018-135347040 GTGGGTACAGAGTTCCAGTTTGG - Intergenic
1033218916 7:139514909-139514931 AAGGGCACAAAGTTTCCCTTAGG - Intergenic
1033432572 7:141302522-141302544 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1033621495 7:143065825-143065847 GAGGGTACAAGGTTTCAGTTGGG - Intergenic
1034527165 7:151672497-151672519 ACGGAGACAGAGTTTCAGTTTGG - Intronic
1034664778 7:152807996-152808018 ACGGGGACAGAGTTTTAGTTTGG - Intronic
1034695957 7:153053918-153053940 AAAGGCACAAAGTTTCAGTTAGG - Intergenic
1034875945 7:154724796-154724818 ACGGGGACAGAGTTTCAGTCTGG + Intronic
1035109058 7:156465047-156465069 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1035147831 7:156838330-156838352 AAGGGTACAAAATTTCAGTTAGG - Intronic
1035167646 7:157000863-157000885 TTGGGGACAGAGTTTCAGTTTGG - Intronic
1035540179 8:428660-428682 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1036015773 8:4782146-4782168 ATGGGTACAAAGTTACAGTTAGG + Intronic
1036407296 8:8466600-8466622 GAGGGTAGAAAGTTTCAGTGAGG - Intergenic
1036705942 8:11047024-11047046 AAGGGCACAAAGTTTCAATTCGG + Intronic
1036821806 8:11946071-11946093 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
1037710287 8:21349968-21349990 AAGGGTACAAAATTTCAGTTAGG + Intergenic
1038155549 8:24985983-24986005 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1038208964 8:25497601-25497623 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1038624943 8:29182758-29182780 AAGGGTACAAAGTTTCTGTTAGG + Intronic
1039209148 8:35192100-35192122 AAGGGTATAAAGTTTCAGTTAGG - Intergenic
1039677946 8:39690652-39690674 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1039975935 8:42364819-42364841 AATGGCACAGAGTTTCAGTTGGG + Intronic
1040037258 8:42882734-42882756 ATGGGCATAAAGTTTCTGTTAGG + Intronic
1040040325 8:42909965-42909987 GAGGGCATGAAGTTTCTGTTAGG + Intronic
1040994098 8:53384013-53384035 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1041061889 8:54042545-54042567 GTGGGTACAGGGTTTCAGTTTGG + Intergenic
1041339325 8:56825580-56825602 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1041379565 8:57239656-57239678 ATGGGCACAGAGTTTCTGTTTGG - Intergenic
1041687564 8:60658329-60658351 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1041758664 8:61340310-61340332 AAGGACACAAAATTTCAGTTAGG - Intronic
1041853802 8:62425156-62425178 ACAGGTATAAAGTTTCAGTTAGG + Intronic
1042952235 8:74212788-74212810 ATGGGTACAAAGCTTCAGTTTGG - Intergenic
1042959322 8:74286524-74286546 ATGGGTACAAAGTTACAGTTAGG - Intronic
1043429569 8:80181821-80181843 ACAGGTACAGAGTTTCAGTTGGG + Intronic
1043550589 8:81367846-81367868 GAGGGTACAAAGTTGCAGCTGGG + Intergenic
1044819989 8:96149610-96149632 AAGGGTACAAATTTTCAGTTAGG + Intronic
1045289467 8:100820143-100820165 GTGGGTACAAAGTTTCAGCTTGG + Intergenic
1045862096 8:106825085-106825107 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1046889884 8:119411261-119411283 GTGGGTACAAAGCTACAGTTAGG - Intergenic
1047824487 8:128558796-128558818 AAGGACACAAATTTTCAGTTAGG + Intergenic
1048300428 8:133247428-133247450 GCTGCCACAAAGTTGCAGGTGGG + Intronic
1048506067 8:135023095-135023117 GTGGGCACAAAGGTAAAGTTAGG - Intergenic
1049183842 8:141238435-141238457 GTGGGGACAGAGTTTCAGTCTGG - Intronic
1049916582 9:323625-323647 ACGGGTACAGAGTTTCAGTTTGG - Intronic
1051485440 9:17603496-17603518 ACGGGTACAGAGTTTCAGATGGG + Intronic
1052344472 9:27395183-27395205 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1052581928 9:30368414-30368436 AAGGACACAAAGTTACAGTTAGG - Intergenic
1053112250 9:35471554-35471576 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1053317360 9:37063337-37063359 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1053398227 9:37794768-37794790 ACGGGTACAGAGTTTCAGTCTGG + Intronic
1054839932 9:69727275-69727297 AAGGGTACAAAGTTTCCGTTAGG - Intronic
1055245598 9:74238878-74238900 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1056083719 9:83123926-83123948 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1056296143 9:85194918-85194940 ACAGGTACAAAGTTACAGTTAGG + Intergenic
1056419255 9:86407820-86407842 ATGGGCATAGAGTTTCAGTTTGG - Intergenic
1056707485 9:88964403-88964425 AAGGGTACAAAGTTTTAGTTAGG + Intergenic
1057193527 9:93100681-93100703 ACGGGTACAAAATTTCTGTTTGG - Intronic
1057203311 9:93155405-93155427 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1057246791 9:93462655-93462677 GTGGGTACACAGTTCCAGTTTGG - Intronic
1057842601 9:98498257-98498279 ATGGGCACAGAGTTTCAGTGTGG + Intronic
1058342509 9:103916316-103916338 TAGGGTACAAAGTTTCTGTTAGG - Intergenic
1058853973 9:109041608-109041630 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1058970989 9:110082819-110082841 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1059182053 9:112225433-112225455 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1059275491 9:113093217-113093239 GTAGGTACAAAGTTGCAGTTAGG + Intergenic
1060263437 9:122094721-122094743 ATAGACACAAAGTTTCAGTTTGG - Intergenic
1060469423 9:123935379-123935401 ATGGGTATAAAGTTTCAGTTTGG - Intergenic
1061503356 9:131016276-131016298 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1061560749 9:131401301-131401323 ATGGGAACAGAGTTTCAGTTTGG - Intronic
1062351365 9:136141051-136141073 GTGGGAACAGAGCTTCAGTTTGG - Intergenic
1062383479 9:136298812-136298834 GTGGGGACAGAGTTTCAGTTTGG + Intronic
1185987738 X:4854694-4854716 AAGAGTACAAAGTTTCAGTTAGG + Intergenic
1186420720 X:9423709-9423731 GCGGGGACAGAGTTTCAGTTTGG - Intergenic
1186489679 X:9961726-9961748 ACGGGGACAGAGTTTCATTTGGG - Intergenic
1186764519 X:12757153-12757175 AGGGGCACAGAGTTTCAGTTTGG + Intergenic
1186781299 X:12914873-12914895 TAGGACACAAAATTTCAGTTAGG + Intronic
1187059450 X:15771983-15772005 AAAGGTACAAAGTTTCAGTTAGG - Intronic
1187309863 X:18131614-18131636 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1187634677 X:21213562-21213584 ACAGGTACAAAGTTACAGTTAGG + Intergenic
1187820384 X:23281395-23281417 ATGGACACAAAGTTTCTGTTTGG + Intergenic
1188218880 X:27514922-27514944 GTGGGTACAACGTTACAGTTAGG + Intergenic
1188863610 X:35287149-35287171 AAGGACACAAAATTTCAGTTAGG + Intergenic
1189815996 X:44824441-44824463 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1189844561 X:45121903-45121925 AAAGGTACAAAGTTTCAGTTAGG + Intergenic
1189901175 X:45707883-45707905 ATGGGCACAGAGTTTCTGTTTGG + Intergenic
1190001921 X:46697197-46697219 AAGGATACAAAGTTTCAGTTAGG + Intronic
1190942849 X:55059729-55059751 AAGGGTTCAAAGTTTCAGTTAGG - Intergenic
1192262455 X:69513873-69513895 ATGGGCACAGAGTTTCTGTTTGG - Intronic
1192268073 X:69554030-69554052 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1192400684 X:70831644-70831666 GGGGTTACAAAGTTTCATTTAGG + Intronic
1192413608 X:70957153-70957175 ATGGATACAAAGTTTCAGTTGGG + Intergenic
1193131015 X:77919889-77919911 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1193242517 X:79187820-79187842 ATGGATACAAAGTTTCAGTTTGG - Intergenic
1193890448 X:87038757-87038779 AAGGGTACAAAGTTCCAGTTAGG + Intergenic
1194104103 X:89746999-89747021 ATGGGCAGAGAGTTTCAGTTTGG + Intergenic
1195280214 X:103326014-103326036 ACGGGCACAAAGTTTCAGTTTGG - Intergenic
1195677588 X:107519097-107519119 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1195914057 X:109918420-109918442 GTGGGTACAAAGTTACAGTTAGG - Intergenic
1196502959 X:116407185-116407207 GAGAGTACAAAGTTTCAGTTAGG - Intergenic
1196515774 X:116608669-116608691 AAGGACACAAAATTTCAGTTAGG - Intergenic
1196671381 X:118371337-118371359 GAGGGTACAAAGTTTTAGTTAGG + Intronic
1197552690 X:127913349-127913371 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1197590288 X:128401180-128401202 AGGGGTACAAAGTTTCATTTAGG + Intergenic
1197740031 X:129884181-129884203 GTGGGTACAGAGTTTCAGTATGG - Intergenic
1198248969 X:134860953-134860975 ACGGGTACAGAGTTTCTGTTTGG + Intergenic
1198992807 X:142535572-142535594 ATGGGCACAGAGCTTCAGTTTGG - Intergenic
1199154504 X:144530760-144530782 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1199287879 X:146074096-146074118 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1199426787 X:147711625-147711647 GGGGGTACAAAATTTCAGTTAGG - Intergenic
1199440446 X:147862077-147862099 ATGGGTACAGAGTTTCAGTTGGG + Intergenic