ID: 996081223

View in Genome Browser
Species Human (GRCh38)
Location 5:119260459-119260481
Sequence CTGTATCCTCACATGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996081223_996081226 5 Left 996081223 5:119260459-119260481 CCAAAGACCATGTGAGGATACAG No data
Right 996081226 5:119260487-119260509 AAGTGGTCATCTGCAAGCTAAGG No data
996081223_996081227 12 Left 996081223 5:119260459-119260481 CCAAAGACCATGTGAGGATACAG No data
Right 996081227 5:119260494-119260516 CATCTGCAAGCTAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996081223 Original CRISPR CTGTATCCTCACATGGTCTT TGG (reversed) Intergenic
No off target data available for this crispr