ID: 996087818

View in Genome Browser
Species Human (GRCh38)
Location 5:119322265-119322287
Sequence GTGAGCACTGCTGATGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 584}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996087818_996087820 7 Left 996087818 5:119322265-119322287 CCAGCACCATCAGCAGTGCTCAC 0: 1
1: 0
2: 0
3: 25
4: 584
Right 996087820 5:119322295-119322317 AAATGACCTATACATACTTGTGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996087818 Original CRISPR GTGAGCACTGCTGATGGTGC TGG (reversed) Intronic
900323574 1:2096549-2096571 GTGAGCAGTGCAGATGCTGTTGG + Intronic
900618581 1:3576717-3576739 GTGTGCAGGGCTGAGGGTGCAGG - Intronic
900841013 1:5048629-5048651 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
902216114 1:14935469-14935491 TCGGGCACTGCTGATGTTGCTGG - Intronic
902293996 1:15453837-15453859 CTGAGCTGTGCTGATGCTGCTGG + Intergenic
904711865 1:32436120-32436142 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
904996257 1:34633885-34633907 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
905500012 1:38428851-38428873 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
905509532 1:38507792-38507814 CTGAGCACTGGCGATGGAGCTGG - Intergenic
905832967 1:41089074-41089096 CTGGGCAGTGCTGATGCTGCTGG + Intronic
905951907 1:41958969-41958991 GTGAGCACTGATGATGGAAGAGG + Intronic
906081149 1:43089285-43089307 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
907292855 1:53428074-53428096 GTGAGTACAGCTGAAGGAGCGGG - Intergenic
907386039 1:54125862-54125884 GTGAGCCCTGCTGATTTTCCAGG + Intergenic
907503342 1:54899796-54899818 GTGAGTACAGCTGAAGGAGCGGG + Intergenic
907521491 1:55026379-55026401 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
908852640 1:68390048-68390070 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
909223430 1:72989741-72989763 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
909550801 1:76896704-76896726 GTGAGTACAGCTGAAGGAGCCGG + Intronic
909792752 1:79698291-79698313 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
909931391 1:81503378-81503400 GTGAGAGCTGCTGCTGCTGCTGG - Intronic
909978221 1:82069448-82069470 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
910864852 1:91779049-91779071 GTGAGCAATGGTGAGAGTGCTGG + Intronic
914900275 1:151707769-151707791 GTGAGCACTGCCCCTGATGCCGG - Intronic
915511979 1:156391473-156391495 GAGAGCAGGGCTGCTGGTGCAGG - Intergenic
915980890 1:160419352-160419374 GCGTGCCCTGCTTATGGTGCTGG + Exonic
917178049 1:172261509-172261531 GTGTGCACTGGTGCTGGTGTTGG + Intronic
918347347 1:183617429-183617451 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
918567440 1:185950225-185950247 GTGAGTACAGCTGAAGGAGCCGG + Intronic
919476634 1:198038558-198038580 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
919740331 1:200977307-200977329 CTGAGCACTGGTGATGGCACGGG + Exonic
920285959 1:204879945-204879967 GTGGGCACAGCTGGTGGTGCTGG + Intronic
920987122 1:210901335-210901357 GTGAGCTCTGATGATGGTGGTGG - Intronic
921410897 1:214835570-214835592 GAGAGCAGTTTTGATGGTGCAGG + Intergenic
921732746 1:218595728-218595750 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
922049308 1:221975034-221975056 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
922877312 1:228950014-228950036 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
922906622 1:229178211-229178233 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
923075459 1:230605164-230605186 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
923244982 1:232121962-232121984 GTGAGCACAGCTGAAGGAGCCGG - Intergenic
923257108 1:232231561-232231583 GTGAGCACAGCTGAAGGAGCCGG + Intergenic
923408397 1:233685363-233685385 GTGAGCACAGCTGAAGAAGCCGG + Intergenic
923770514 1:236934195-236934217 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
923963017 1:239105144-239105166 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1063363415 10:5475100-5475122 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1064886767 10:20121098-20121120 GTGAGTACAGCTGAAGGAGCTGG + Intronic
1065125491 10:22569574-22569596 TTGAGCACTGCCTATGATGCTGG + Intronic
1065442895 10:25770680-25770702 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1065679581 10:28215100-28215122 GTGAGAAGTGCTGATTGTTCAGG - Intronic
1067190278 10:44062753-44062775 GTGAGTGCTGGTGAGGGTGCAGG + Intergenic
1068641633 10:59414288-59414310 GTGGGCACAGCTCATGGAGCAGG - Intergenic
1069694628 10:70377492-70377514 GTGAGCACTGGCTATGGAGCTGG - Intronic
1070934094 10:80280248-80280270 GTGAGCAAGGATGATGGTGAGGG + Exonic
1071897514 10:90082968-90082990 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1071916432 10:90298774-90298796 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1073612975 10:104962594-104962616 GTGAGCACAACTCGTGGTGCAGG - Intronic
1073709256 10:106019560-106019582 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1074741036 10:116484593-116484615 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1074887320 10:117704490-117704512 CTGGGCACTGTTGATGGTGCAGG - Intergenic
1075248934 10:120848621-120848643 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1076006702 10:126953519-126953541 GGTAGTACTGCTGATGGTGGTGG + Intronic
1076230295 10:128814743-128814765 TTGTGCTCTGCTGATGGTGGAGG - Intergenic
1076483871 10:130803103-130803125 GTGTGCACTGCTGGTGGGGTGGG + Intergenic
1076894283 10:133302297-133302319 GTGAGCACTGCCCCTGGTGCAGG - Intronic
1077055862 11:592774-592796 GTGAGCACAGCTCCAGGTGCTGG - Intronic
1077612422 11:3651715-3651737 GTGAGTACAGCTGAAGGAGCTGG - Intronic
1077766158 11:5162212-5162234 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1077883620 11:6369793-6369815 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1078045910 11:7914096-7914118 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1079230784 11:18647032-18647054 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1079672337 11:23185869-23185891 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1079726854 11:23889120-23889142 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1079847418 11:25488945-25488967 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1080027683 11:27631011-27631033 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1081665910 11:44917053-44917075 GTCAGCACAGGTGTTGGTGCAGG - Intronic
1083367144 11:62148279-62148301 GTGTGCACACCTGAGGGTGCAGG - Intronic
1083534641 11:63456689-63456711 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1084232531 11:67763444-67763466 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1084355782 11:68637481-68637503 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1084515142 11:69633964-69633986 GTGAGCCCTGCTGGCGGTGATGG - Intergenic
1084755115 11:71233487-71233509 GGGAGCAATGCTGATGGTTTTGG + Intronic
1085570483 11:77554026-77554048 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1085850798 11:80117373-80117395 GTTAGCAGAGCTGCTGGTGCAGG + Intergenic
1085934506 11:81125568-81125590 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1086105086 11:83138722-83138744 GTGAGCACTGTTCAAGGAGCTGG - Intergenic
1086134570 11:83433334-83433356 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1086550474 11:88047173-88047195 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1086951732 11:92897671-92897693 GTGAGCTCTGCTGCTGGCGCAGG - Intergenic
1087099897 11:94353619-94353641 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1087839275 11:102905807-102905829 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1088555217 11:111054179-111054201 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1089749077 11:120637422-120637444 CTGAGCAGTGCTGATGGAACAGG + Intronic
1089987904 11:122830894-122830916 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1090107337 11:123867303-123867325 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1090127671 11:124105255-124105277 GTGAGCACTGCAGGTGGAGAAGG + Intergenic
1090134783 11:124185979-124186001 GTGAGCACTGCAGGTGGAGAAGG - Exonic
1090526545 11:127544459-127544481 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1090546235 11:127770802-127770824 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1090610448 11:128466372-128466394 GTCAGCACATCTGCTGGTGCTGG + Intronic
1090610604 11:128467345-128467367 GTGAGAACTTCTGATGGGCCTGG - Intronic
1090871736 11:130755444-130755466 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1091778191 12:3198310-3198332 GTGGCCTGTGCTGATGGTGCTGG - Intronic
1092578471 12:9814552-9814574 GTCAGGCCTCCTGATGGTGCAGG - Intergenic
1092626523 12:10334861-10334883 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1092789939 12:12062165-12062187 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1092924557 12:13261520-13261542 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1093321759 12:17722131-17722153 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1093358718 12:18199103-18199125 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1093579046 12:20767146-20767168 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1095637869 12:44453577-44453599 GTGAGCATAGCTGAAGGAGCCGG - Intergenic
1095778456 12:46034131-46034153 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1096615605 12:52831563-52831585 GTGGGCACTGCTGCAGGAGCAGG - Exonic
1097398814 12:59105611-59105633 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1098028970 12:66235156-66235178 GTTATTACTGCTGGTGGTGCTGG + Intronic
1098402485 12:70089182-70089204 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1098629289 12:72707134-72707156 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1098653562 12:73003735-73003757 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1098920184 12:76295609-76295631 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1099188945 12:79543643-79543665 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1099291869 12:80785013-80785035 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1100561588 12:95752944-95752966 GCGAGCACAGCTGAAGGAGCCGG - Intronic
1100940577 12:99719279-99719301 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1101278167 12:103224611-103224633 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1101533544 12:105596494-105596516 GTAGGCACTGCTGATGGTGGAGG + Intergenic
1103933688 12:124463955-124463977 GTGAGCACTGTTTTAGGTGCTGG + Intronic
1104750159 12:131233228-131233250 CTGGGCACTGCTGTGGGTGCTGG - Intergenic
1104782557 12:131431233-131431255 CTGGGCACTGCTGTGGGTGCTGG + Intergenic
1105291399 13:19055919-19055941 ATGGGCACTGCTGATGGCGATGG + Intergenic
1105652887 13:22399901-22399923 CTGAGCTCTGCTTATGGAGCTGG + Intergenic
1106054570 13:26226438-26226460 GCTAGCACTTCTGCTGGTGCAGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1107010423 13:35665093-35665115 GTGAGGACGGCTCTTGGTGCCGG - Exonic
1107075811 13:36320224-36320246 GTGAGTACAGCTGAAGGCGCCGG - Intronic
1108680468 13:52775876-52775898 CTGTGCAGTTCTGATGGTGCAGG + Intergenic
1108742893 13:53356942-53356964 GTGAGTAGAGCTGATGGTGGAGG + Intergenic
1108814357 13:54270641-54270663 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1108919321 13:55656894-55656916 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1109343859 13:61092516-61092538 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1110650226 13:77935052-77935074 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1110845574 13:80187459-80187481 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1111125811 13:83910214-83910236 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1111302274 13:86362187-86362209 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1111361878 13:87188353-87188375 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1111458610 13:88514760-88514782 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1111631474 13:90850519-90850541 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1112237092 13:97646287-97646309 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1113927901 13:113951478-113951500 GTGGGCAGTGCTGTTGGTGGCGG - Intergenic
1116534545 14:46014354-46014376 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1116573682 14:46547694-46547716 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1116703063 14:48264298-48264320 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1117801413 14:59447860-59447882 GTGAGTACAGCTGAAGGAGCTGG - Intronic
1118936977 14:70297352-70297374 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1119022648 14:71128090-71128112 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1119317428 14:73707270-73707292 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1120251129 14:82062808-82062830 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1120659670 14:87236592-87236614 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1121452309 14:94016774-94016796 ATGTGCACTGTTCATGGTGCTGG - Intergenic
1121573513 14:94965091-94965113 GCAAGCACTTCTGTTGGTGCAGG - Intergenic
1121703915 14:95976942-95976964 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1122041224 14:98988978-98989000 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1122213807 14:100190372-100190394 GTGAGCAATGATGATGCCGCAGG - Intergenic
1122890116 14:104728297-104728319 CTCTGCACTGTTGATGGTGCTGG + Intronic
1123804243 15:23854845-23854867 GTGAGCTTTGCTGAAGGGGCAGG - Intergenic
1123992544 15:25694325-25694347 GTCAGCTGTGCTGATGGTTCTGG - Intronic
1125695212 15:41630825-41630847 GTGAGTACTGCTGATTCTACTGG - Intronic
1126529920 15:49701070-49701092 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1126912182 15:53428770-53428792 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1127319785 15:57831789-57831811 CTGAGCACTGCTGATATTGTGGG - Intergenic
1127481527 15:59382007-59382029 CTGAGCACTGTTGTAGGTGCTGG + Intronic
1128606303 15:69038957-69038979 AGGAGCACTGCTGATGGTGAAGG - Exonic
1128756528 15:70187276-70187298 GTGAGAGCTGCTGCTGGGGCTGG + Intergenic
1129295055 15:74595683-74595705 GTGAGAGCTGCTGCTGCTGCTGG - Exonic
1129306842 15:74671524-74671546 TTGAGCACTGTTGCTGCTGCGGG + Exonic
1130134897 15:81174304-81174326 GTGTCCACTGCAGATGTTGCAGG + Intronic
1130855334 15:87835050-87835072 GTGAGTACAGCTGAAGGAGCAGG - Intergenic
1131448001 15:92515493-92515515 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1131684408 15:94754553-94754575 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1131882285 15:96873751-96873773 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1132263276 15:100444282-100444304 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1132340654 15:101076321-101076343 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1132463161 16:65520-65542 GTGAGCACAGCTGGGGTTGCAGG + Intronic
1132747685 16:1443773-1443795 GTGAGCCCTGCAGGGGGTGCTGG - Intronic
1133743067 16:8666006-8666028 GTGGCCACAGGTGATGGTGCAGG + Intergenic
1133765496 16:8834960-8834982 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1133766501 16:8841857-8841879 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1135941000 16:26821876-26821898 CTGAGTAATGCTGATGCTGCTGG + Intergenic
1136630070 16:31484838-31484860 GTGGCCACTGCCGATGTTGCTGG - Exonic
1137240413 16:46651027-46651049 GTGGGGAGTGCTGATGGTTCAGG + Intergenic
1137678138 16:50314407-50314429 GTGAGCCCGGGTGATGGAGCGGG + Intronic
1138474489 16:57262884-57262906 GTGAGCACTGATGAGGGCTCTGG - Intronic
1138758866 16:59519568-59519590 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1138805178 16:60082613-60082635 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1139039008 16:62981076-62981098 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1139230354 16:65277183-65277205 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1139943490 16:70622726-70622748 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1141341496 16:83208114-83208136 GTGAGCACTGCTGATTGATAAGG + Intronic
1141864972 16:86743960-86743982 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1142153438 16:88522692-88522714 GTGGCCACTGCTGGTGGGGCCGG + Intronic
1142519968 17:497829-497851 CTGGGCACTGCTGCCGGTGCTGG + Intergenic
1143345446 17:6245588-6245610 GTGAGCACTTCTGATGTGCCAGG + Intergenic
1143479612 17:7220750-7220772 TTGAGCACTGCAGAGGGTGGGGG - Exonic
1144451552 17:15384227-15384249 GAGAGCACTGCTTTTGGAGCTGG - Intergenic
1144960009 17:19039601-19039623 GTGGCCCCTGCTGATGGGGCTGG + Intronic
1144975151 17:19134923-19134945 GTGGCCCCTGCTGATGGGGCTGG - Intronic
1151202587 17:72479519-72479541 GTGAGCAATACTGATGGAGGTGG - Intergenic
1151622717 17:75256349-75256371 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1152711464 17:81872220-81872242 GCGAGCACTGCTGCTGGGCCAGG - Intergenic
1152890588 17:82879527-82879549 GTGAGCCCTTCTGGTGCTGCTGG + Intronic
1154336682 18:13471563-13471585 GAGAGTAATGCTGATGCTGCTGG + Intronic
1155174093 18:23288040-23288062 GTGAGTACAGCTGAAGGAGCAGG - Intronic
1155328343 18:24688902-24688924 GTGTGCATTTCTGATGATGCTGG + Intergenic
1155696785 18:28695043-28695065 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1155915997 18:31557611-31557633 GTGAGCACAGCAGAAGGTGTGGG + Intergenic
1156237627 18:35219761-35219783 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1156251669 18:35358048-35358070 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1156420397 18:36946432-36946454 CTGAGTAATGCTGATGTTGCTGG - Intronic
1156929007 18:42618339-42618361 CTGAGCATTCCTGATGGTGCTGG - Intergenic
1156938759 18:42740429-42740451 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1157227503 18:45880448-45880470 GTGAGCGCTGCTGAAGCTGGTGG + Intronic
1158544591 18:58385472-58385494 GTGAGCACTAGTGATGATGGAGG + Intronic
1159098941 18:63937172-63937194 GTGTGGACAGATGATGGTGCAGG - Intergenic
1159164714 18:64685410-64685432 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1159835273 18:73328422-73328444 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1160099420 18:75906170-75906192 GTGCGCAATGCTGCTGGAGCTGG - Intergenic
1160419708 18:78735627-78735649 GTGTGCACTGCGGAGGGAGCAGG - Intergenic
1160513035 18:79463168-79463190 CTGAGCACCACTGAAGGTGCAGG - Intronic
1162380558 19:10329329-10329351 GTGAGCGCTGCTGTGGGTGCAGG - Intronic
1162706794 19:12561025-12561047 GTGAGCACTGGGGGTGGTGCCGG + Intronic
1163487527 19:17597207-17597229 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1164220291 19:23187248-23187270 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1165394202 19:35555417-35555439 GTGAGCCCTGCTGATGAGGGTGG - Intronic
1166498702 19:43325439-43325461 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1166645275 19:44526921-44526943 GTGAGCACAGCTGCTGGGGTTGG - Intronic
1166926866 19:46275054-46275076 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1167210693 19:48132398-48132420 GTGGGCTCCGCTGATGCTGCTGG - Intronic
1167652614 19:50741221-50741243 GTGGGAATTGCTGAAGGTGCAGG - Intergenic
1168211898 19:54896825-54896847 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1168248486 19:55126800-55126822 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1168650122 19:58087238-58087260 CTGAGCACTGGTGATGGGGAGGG + Intronic
925912054 2:8580523-8580545 GTGTGCACTGGGGGTGGTGCTGG - Intergenic
926104489 2:10141838-10141860 GTATGCACTGCTGCAGGTGCTGG + Exonic
926413819 2:12630283-12630305 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
926815314 2:16793867-16793889 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
928770589 2:34699038-34699060 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
928771027 2:34702129-34702151 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
928857401 2:35816867-35816889 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
928928800 2:36602815-36602837 GTGAGTACAGCTGAAGGAGCCGG - Intronic
929030965 2:37649600-37649622 GTGTGTGCTGCTGAGGGTGCAGG + Intronic
929571310 2:43024729-43024751 GTGAGCAGGGCGGAAGGTGCAGG - Intergenic
929693146 2:44091266-44091288 ATAAACACTGCAGATGGTGCCGG + Intergenic
930706460 2:54509342-54509364 GTGAGTACAGCTGAAGGAGCCGG + Intronic
930955324 2:57196736-57196758 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
931237167 2:60421382-60421404 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
931287877 2:60847854-60847876 GTAAGCACTGCTCCAGGTGCTGG - Intergenic
931402437 2:61943518-61943540 TTGAGCCCTCCTCATGGTGCTGG - Intronic
931665051 2:64604486-64604508 GTGACCAATCCTGATGGGGCTGG - Intergenic
931948517 2:67335593-67335615 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
932294864 2:70615898-70615920 GTGTGTTCTGCTGATGGTTCAGG + Intronic
932367967 2:71164928-71164950 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
932853980 2:75215701-75215723 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
932973686 2:76575568-76575590 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
933013319 2:77092157-77092179 GTGAGTACAGCTGAAGGAGCCGG - Intronic
933079492 2:77968886-77968908 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
933658822 2:84909859-84909881 GTTGGCAATGCTGATGGTGGAGG - Intergenic
934033283 2:88066787-88066809 CTTAGCACTGCTGGTGATGCTGG - Intergenic
935943861 2:108268948-108268970 GAAAGCACTGCTGATGGGGCAGG - Intergenic
936092011 2:109507531-109507553 GAGACCACTGCTTCTGGTGCTGG - Intergenic
939073570 2:137572410-137572432 GTGAATACTGCGGATGGTGAAGG + Exonic
939095045 2:137824808-137824830 CTTAGCACTGCTAATGGTACTGG - Intergenic
939307635 2:140429917-140429939 GTGAGTACAGCTGAAGGAGCCGG - Intronic
940530420 2:154871094-154871116 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
940567722 2:155389276-155389298 GTAAGAATTGCTGATGCTGCAGG + Intergenic
940675583 2:156721999-156722021 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
940834331 2:158503897-158503919 TGGAGCATTGCTGATGGTGCTGG + Intronic
941016836 2:160367329-160367351 GTTATTACTGCTGGTGGTGCTGG + Exonic
941340624 2:164299629-164299651 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
941353613 2:164462895-164462917 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
941750847 2:169134324-169134346 GTGAGTACAGCTGAAGGAGCTGG - Intronic
941759987 2:169231673-169231695 GTGAGCTCTGAAGATGGAGCTGG - Intronic
941935629 2:170979358-170979380 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
943412695 2:187562416-187562438 GTGAGTACAGCTGAAGGAGCCGG + Intronic
943421349 2:187672419-187672441 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
943835627 2:192511252-192511274 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
943865602 2:192922050-192922072 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
943951038 2:194132606-194132628 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
944394365 2:199250710-199250732 GTGAGTACGGCTGAAGGAGCCGG - Intergenic
945301193 2:208217789-208217811 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
946886729 2:224229070-224229092 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
948715561 2:239858924-239858946 GAGTGCATTGCTGATGGTGCCGG + Intergenic
1168739530 20:176013-176035 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1168881578 20:1210730-1210752 CTGAGCACTGCTTATGTTCCAGG - Intergenic
1170106462 20:12757657-12757679 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1170165967 20:13360730-13360752 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1170680175 20:18519320-18519342 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1170820470 20:19753088-19753110 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1171032614 20:21691109-21691131 GTGGGCACTGCTCCAGGTGCTGG + Intergenic
1171189778 20:23150828-23150850 CAGTACACTGCTGATGGTGCTGG - Intergenic
1172053722 20:32139550-32139572 GTGAGCAGTGGTGGTGGTGGGGG - Intronic
1172620734 20:36316706-36316728 GGGAGCACTGCTGAAGGGGACGG - Intronic
1173102137 20:40097113-40097135 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1173650891 20:44663397-44663419 GAGAGGACTGCAGATAGTGCGGG - Intergenic
1173652334 20:44674517-44674539 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1173781946 20:45763439-45763461 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1174408403 20:50317948-50317970 GTGAGCTTTGCTCATGGGGCAGG - Intergenic
1174519288 20:51117346-51117368 GTGAGCAGTCCTGATGGTGGTGG + Intergenic
1174800451 20:53559049-53559071 GTGTGCGCTGCTGCTGGTGGTGG - Intergenic
1176667770 21:9703565-9703587 GTGAGCATTTCTGTTGGTGTTGG - Intergenic
1177102939 21:16917979-16918001 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1177119803 21:17125269-17125291 GTGAGTACGGCTGAAGGAGCCGG - Intergenic
1177840487 21:26229744-26229766 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1178001421 21:28164983-28165005 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1178961586 21:37071593-37071615 GCAAGCTGTGCTGATGGTGCAGG + Intronic
1179014992 21:37588658-37588680 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1179318798 21:40270436-40270458 GGGAGGACTGCTGGGGGTGCTGG + Intronic
1179650101 21:42802761-42802783 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1181300116 22:21873906-21873928 GTGAATAATGCTGATGCTGCTGG - Intergenic
1181423015 22:22814880-22814902 CTGGGCACTGCTGATGGTCAGGG - Intronic
1181425480 22:22834913-22834935 GTGCTCACTGCTCAGGGTGCAGG - Intronic
1181427063 22:22850578-22850600 CTGAGCCCTGCTGATGGTCAGGG - Intronic
1181429719 22:22871783-22871805 GTGCTCACTGCTTAGGGTGCAGG - Intronic
1181685959 22:24528417-24528439 GTGATCATTGCTGATGCTACAGG + Intergenic
1181904634 22:26184541-26184563 GTGGGCTCTGCTGTAGGTGCTGG + Intronic
1182033573 22:27180054-27180076 GTGTGCACTTCTGCTGGGGCCGG - Intergenic
1182318694 22:29464454-29464476 GGGAGCACTGCTGGCTGTGCAGG - Intergenic
1182725414 22:32441450-32441472 CTGAGCACTGTTCTTGGTGCTGG - Intronic
1182732509 22:32506552-32506574 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1182998830 22:34838095-34838117 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1183123575 22:35752444-35752466 GTGGGCACTGCTGAGGTAGCAGG + Intronic
1183726164 22:39590780-39590802 GAGAACTCTGCTGATGTTGCAGG + Intronic
1184289977 22:43493419-43493441 TTGAGCACTGGTGCTGGTGATGG + Intronic
1184520617 22:44991776-44991798 GTGAGTCCTGCTTATGGAGCTGG - Intronic
949161856 3:892597-892619 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
949827671 3:8180790-8180812 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
949938935 3:9138940-9138962 ATGAGCACTACTGTTGGTACAGG - Intronic
950181820 3:10918729-10918751 GTGAGCAGTGATGGTGGTCCGGG - Intronic
950303313 3:11900058-11900080 GGGAGCACTGCTGCTCGTCCAGG - Intergenic
950506743 3:13399797-13399819 GGGAGCACTGCTGCTCGTCCAGG + Exonic
950926718 3:16748096-16748118 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
951298585 3:20969441-20969463 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
952297162 3:32071732-32071754 GTGAGTACAGCTGAAGGAGCCGG - Intronic
952343341 3:32463348-32463370 GTGAGTACAGCTGAAGGAGCCGG + Intronic
952534370 3:34294648-34294670 CTGAGCAGTGCTGCAGGTGCTGG + Intergenic
952663233 3:35876258-35876280 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
952823105 3:37502107-37502129 GTCAGCATTGGTGATGGTTCTGG + Intronic
952895825 3:38078206-38078228 GTGAGTACAGCTGAAGGAGCCGG + Intronic
953076895 3:39579733-39579755 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
953177433 3:40564756-40564778 GTGAGTACAGCTGAAGGAGCCGG - Intronic
953878238 3:46678571-46678593 GTGGGCACAGCTGTTGGTGGGGG - Intronic
954330341 3:49886592-49886614 GTGGGCACTGCAGATCGAGCAGG + Intergenic
954853729 3:53625249-53625271 CTGAGCACTGGTGCTGATGCTGG + Intronic
955968681 3:64414790-64414812 GTGAACACAGCTGATGGTTTTGG - Intronic
956548733 3:70436581-70436603 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
956678159 3:71754163-71754185 GTTCGCGCTGCTGATCGTGCGGG + Exonic
956709480 3:72026981-72027003 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
957295458 3:78327572-78327594 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
957317079 3:78585072-78585094 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
958183103 3:90084842-90084864 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
959972037 3:112419489-112419511 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
960309894 3:116107249-116107271 GTGAGTACAGCTGAAGGAGCCGG + Intronic
961164534 3:124754489-124754511 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
961730814 3:128963471-128963493 GTGAGTACAGCTGAAGGAGCCGG - Intronic
961881277 3:130063047-130063069 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
962205824 3:133433065-133433087 GTGAGTACAGCTGAAGGTGCCGG - Intronic
962523697 3:136219665-136219687 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
962660898 3:137599468-137599490 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
963425450 3:145116761-145116783 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
963663577 3:148155430-148155452 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
964603219 3:158527208-158527230 GTTAGCAGTGCTGATGATGTTGG - Intronic
964941965 3:162169360-162169382 GAGAGCACTTCTGAAGCTGCAGG + Intergenic
964984609 3:162724115-162724137 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
965286506 3:166826029-166826051 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
965626090 3:170685262-170685284 GTGAGTACAGCTGAAGGAGCCGG + Intronic
965639749 3:170819515-170819537 GTGAGTACTGCTGAAGGAGCTGG + Intronic
966085690 3:176065320-176065342 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
966104873 3:176323568-176323590 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
966232623 3:177667782-177667804 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
966397882 3:179520638-179520660 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
966581173 3:181565754-181565776 GTGAGCACTGATGCTGGCACTGG - Intergenic
967211934 3:187177459-187177481 GTGAGTACAGCTGAAGGAGCCGG + Intronic
967496449 3:190148281-190148303 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
967561607 3:190923891-190923913 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
967643593 3:191897272-191897294 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
967657880 3:192073017-192073039 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
968389224 4:175215-175237 ATGAGGACTGCTGATCCTGCGGG - Intergenic
968480386 4:830547-830569 GTGAGCACAGTGGGTGGTGCTGG + Intergenic
968501221 4:950981-951003 GTGGGCGGTGCGGATGGTGCAGG + Intronic
968781874 4:2588504-2588526 GGGAGCACAGGTGATGGTGATGG + Intronic
968993609 4:3931152-3931174 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
969003560 4:4001980-4002002 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
969653798 4:8484338-8484360 GTGAGTACAGCTGAAGGAGCCGG + Intronic
969810364 4:9642843-9642865 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
970256188 4:14172454-14172476 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
970532963 4:17001445-17001467 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
971122958 4:23723952-23723974 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
971983946 4:33794604-33794626 GGGAGCACTGCAGCTGGTGAGGG - Intergenic
975864862 4:78715791-78715813 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
975933658 4:79555908-79555930 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
976558833 4:86478572-86478594 GTGAGTACAGCTGAAGGAGCCGG - Intronic
976884334 4:89966692-89966714 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
977010534 4:91627861-91627883 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
977062277 4:92273432-92273454 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
978031746 4:103945126-103945148 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
978438844 4:108712930-108712952 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
979054391 4:115977588-115977610 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
979146835 4:117255869-117255891 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
979850080 4:125563564-125563586 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
980111684 4:128642797-128642819 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
980472173 4:133265422-133265444 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
980904168 4:138931644-138931666 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
981539947 4:145836526-145836548 GTGAGTACAGCTGAAGGAGCCGG - Intronic
982083727 4:151814379-151814401 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
982180251 4:152743262-152743284 GTGAGTACAGCTGAAGGAGCCGG + Intronic
982228369 4:153186156-153186178 CTGGGCACTGCTGATGTTGTGGG - Intronic
982446691 4:155498963-155498985 ATGAGCACTGTTTTTGGTGCTGG - Intergenic
982496891 4:156105414-156105436 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
983024106 4:162712878-162712900 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
983055708 4:163096848-163096870 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983345822 4:166524513-166524535 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983360639 4:166720084-166720106 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983448285 4:167880101-167880123 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983452567 4:167926670-167926692 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983659800 4:170120230-170120252 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
983707928 4:170681478-170681500 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
983805568 4:171987962-171987984 GTGAGTACAGCTGAAGGAGCCGG + Intronic
984098783 4:175463116-175463138 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
984437525 4:179724435-179724457 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
985389630 4:189481302-189481324 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
985407034 4:189648029-189648051 GTGAGCATTTCTGTTGGTGTTGG + Intergenic
985435968 4:189929845-189929867 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
985522665 5:385125-385147 TTTAGCACTTCTTATGGTGCAGG + Intronic
985582573 5:706566-706588 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
986193751 5:5519323-5519345 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
986364686 5:7018797-7018819 GTGAGCACTGCCCCTGGTGTTGG + Intergenic
986389100 5:7267363-7267385 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
987282221 5:16423499-16423521 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
987497902 5:18670786-18670808 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
990339744 5:54810394-54810416 GTGAGCATTGGTGATGGGGATGG + Intergenic
990845243 5:60130268-60130290 GTGTGCACTGCTGATTGAGATGG + Intronic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
992394893 5:76361134-76361156 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
994532319 5:100986188-100986210 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
994775904 5:104035389-104035411 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
994778727 5:104066130-104066152 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
995296900 5:110533613-110533635 GTGAGTACAGCTGAAGGAGCCGG - Intronic
995421836 5:111976479-111976501 CTCAGCACTGCTGAAGGTACTGG - Intronic
995899145 5:117048307-117048329 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
996087818 5:119322265-119322287 GTGAGCACTGCTGATGGTGCTGG - Intronic
996358395 5:122620799-122620821 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
996510127 5:124307568-124307590 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
996745174 5:126841275-126841297 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
997220932 5:132163291-132163313 GTGAGCAAGGCTGGGGGTGCTGG - Intergenic
997746626 5:136305090-136305112 GTGAGTACAGCTGAAGGAGCCGG - Intronic
998693436 5:144613072-144613094 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1000439977 5:161252484-161252506 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1001331222 5:170763977-170763999 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1001662923 5:173410008-173410030 GTGTGGACTGCTGATGGTTGTGG + Intergenic
1002495039 5:179606145-179606167 GAAAGCACAGCTGATGGTGGAGG - Intronic
1003429951 6:6029723-6029745 GTGAGGACAGCTGAAGGAGCCGG + Intergenic
1004106486 6:12671138-12671160 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1004283295 6:14298886-14298908 GTGAGTACAGCTGAAGGAGCGGG + Intergenic
1004507769 6:16260923-16260945 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1004768346 6:18756001-18756023 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1004837265 6:19542894-19542916 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1005014428 6:21363439-21363461 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1006025298 6:31142980-31143002 GTGGGCACTGCTGCTGCTACAGG + Exonic
1007212707 6:40208349-40208371 CTGAGCGATGCTGATGCTGCTGG - Intergenic
1007393970 6:41566772-41566794 GGAATCACTGCTGGTGGTGCCGG + Intronic
1008867711 6:56234641-56234663 GTGAGCATTTCTGCTGGTGATGG - Intronic
1009583772 6:65569746-65569768 GTGAGCATTGCTGATTGGTCGGG - Intronic
1010071460 6:71750275-71750297 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1011367640 6:86600095-86600117 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1012066314 6:94555872-94555894 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1013807821 6:114014048-114014070 GTGAGTATTGCTGAAGGAGCTGG + Intergenic
1014069121 6:117161142-117161164 GTTACCACTGCTGAGGTTGCAGG + Intergenic
1014396295 6:120928951-120928973 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1014614442 6:123584225-123584247 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1014719124 6:124895819-124895841 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1015165466 6:130196307-130196329 GTGAGTACAGCTGAAGGAGCTGG - Intronic
1015266970 6:131299230-131299252 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1015269875 6:131327173-131327195 GTGAGAACAGCTGAAGGAGCTGG - Intergenic
1015278381 6:131406593-131406615 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1015287823 6:131506273-131506295 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1015324056 6:131905465-131905487 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1015472527 6:133621727-133621749 GTGACCTCTGATCATGGTGCAGG - Intergenic
1016113919 6:140259382-140259404 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1016249121 6:142019798-142019820 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1016535535 6:145105085-145105107 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1016853501 6:148643580-148643602 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1017389733 6:153925265-153925287 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1017779116 6:157702586-157702608 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1017922592 6:158885122-158885144 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1018084263 6:160288506-160288528 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1018135984 6:160778871-160778893 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1018495170 6:164340670-164340692 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1018521242 6:164654088-164654110 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1019013989 6:168866688-168866710 GTGAGCACTGAGCTTGGTGCAGG + Intergenic
1020316278 7:6907559-6907581 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1021430078 7:20549220-20549242 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1021810876 7:24400055-24400077 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1021977677 7:26026127-26026149 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1022709810 7:32839848-32839870 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1022854520 7:34302051-34302073 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1023196370 7:37643991-37644013 GTGAGCATGGCTGGTGGTGGTGG - Intergenic
1023362515 7:39431106-39431128 GTGCTCATTGCTGATGCTGCGGG + Intronic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1027852178 7:83463442-83463464 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1028088170 7:86663308-86663330 GTGAACTCTACTGATGCTGCTGG + Intronic
1028670731 7:93397711-93397733 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1028913582 7:96234477-96234499 GAAAGCACTACTGATGATGCAGG + Intronic
1029593936 7:101526665-101526687 GTCAGCACTGCTCCTGGTGATGG - Intronic
1029833058 7:103280678-103280700 GTGCGCACTGCGGGTGCTGCAGG - Intergenic
1031004898 7:116459284-116459306 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1031296875 7:120012867-120012889 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1031364538 7:120887560-120887582 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1031422187 7:121565543-121565565 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1031686071 7:124732809-124732831 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1031776543 7:125913771-125913793 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1032257068 7:130305940-130305962 GCCAGGAATGCTGATGGTGCCGG + Intronic
1032270302 7:130398915-130398937 GTGACCACTGCTGAGGGAGCGGG + Exonic
1033278562 7:139990254-139990276 GTGAGCACAGCTGGCGGTGGTGG + Intronic
1033675719 7:143539155-143539177 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1033696115 7:143790289-143790311 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1034761794 7:153679437-153679459 GTCAGCAATGCTGAAGGAGCTGG + Intergenic
1035015740 7:155764286-155764308 GAGAGCACAGCAGATGCTGCTGG - Intronic
1035640665 8:1182734-1182756 GTGAGCTCTGCAGAATGTGCTGG - Intergenic
1036070662 8:5438363-5438385 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1036281703 8:7406209-7406231 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1036339767 8:7905362-7905384 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1039853826 8:41395731-41395753 GTGAGCAGTGATCATGGTGGAGG - Intergenic
1040569000 8:48591711-48591733 GTGACCACTGCTGATGAAGCAGG - Intergenic
1042130013 8:65579067-65579089 GTGTGCACTGATGTTGGTGGTGG + Intergenic
1042453789 8:68976951-68976973 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1042707599 8:71678692-71678714 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1042778637 8:72465506-72465528 GTGAACACTCCTGAGGATGCTGG + Intergenic
1044148290 8:88744147-88744169 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1044258394 8:90092145-90092167 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1044853578 8:96452467-96452489 GTGAGCACAGCTGCTGGCCCAGG - Intergenic
1044922221 8:97178852-97178874 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1045645006 8:104289714-104289736 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1046061907 8:109150410-109150432 TTGAGCACTGCTTTTGGTGCTGG + Intergenic
1046386122 8:113511445-113511467 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1046440238 8:114245116-114245138 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1046443475 8:114285765-114285787 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1046559504 8:115818377-115818399 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1046678746 8:117142892-117142914 ATTAACACTTCTGATGGTGCAGG + Intronic
1046721972 8:117630576-117630598 TTGAGCACAGCTGATATTGCAGG + Intergenic
1047216785 8:122882558-122882580 GTCAGCACTGCTGTTGTTTCTGG - Intronic
1047699577 8:127435498-127435520 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1047829319 8:128613846-128613868 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1048423004 8:134295549-134295571 GTGGGCACTGCTGTGGGTGCCGG - Intergenic
1048457398 8:134590745-134590767 GTGATGACTGTTGATAGTGCTGG - Intronic
1049950207 9:636337-636359 ATTAGCACTGCTGATCATGCAGG + Intronic
1050117876 9:2279550-2279572 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1050257831 9:3812888-3812910 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1050353349 9:4761006-4761028 GGCAGCAATGCTGAGGGTGCAGG - Intergenic
1051953183 9:22660501-22660523 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1052192057 9:25672696-25672718 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1052896820 9:33755062-33755084 CTGAGAACTGCTGATGATGTAGG + Intronic
1053058285 9:35007473-35007495 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1053309807 9:37010621-37010643 GTGAGGACTGGTGGTGGGGCGGG - Intronic
1053783431 9:41633412-41633434 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1054807220 9:69406472-69406494 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1055626988 9:78184800-78184822 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1055762893 9:79628490-79628512 GGGATCACTGCTGATGTTGAGGG + Intronic
1055810279 9:80141193-80141215 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1055881961 9:81012788-81012810 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1056044504 9:82702651-82702673 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1057076006 9:92138472-92138494 GTCAGCACTGGTCACGGTGCAGG + Intergenic
1057378218 9:94543588-94543610 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1057755520 9:97831916-97831938 GTGAGGTTTGCTGAAGGTGCAGG - Intergenic
1057812314 9:98267539-98267561 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1057982313 9:99673938-99673960 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1058612655 9:106792334-106792356 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1060725332 9:126002485-126002507 GTGACAACTGCTGGTGGTGGGGG + Intergenic
1060998435 9:127888014-127888036 GTGAGCACAGCTCTTGGTTCTGG - Intronic
1062029236 9:134354630-134354652 GTGAGCCCTGCTGGTGGAGATGG + Intronic
1203658044 Un_KI270753v1:17134-17156 GTGAGCATTTCTGTTGGTGTTGG + Intergenic
1185858199 X:3555065-3555087 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1185960462 X:4542414-4542436 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1185991287 X:4895361-4895383 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1186112626 X:6274117-6274139 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1186784306 X:12943608-12943630 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1186924136 X:14313554-14313576 GTGTGCACAGATGGTGGTGCTGG + Intergenic
1187086294 X:16046622-16046644 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1188419767 X:29979320-29979342 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1188431292 X:30107331-30107353 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1188463129 X:30450837-30450859 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1188552924 X:31381490-31381512 GTGAGTACAGCTGAAGGAGCCGG - Intronic
1193886149 X:86985577-86985599 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1194186023 X:90775256-90775278 GTGAGTACAGCTGAGGGAGCTGG + Intergenic
1194293391 X:92102175-92102197 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1194308314 X:92274999-92275021 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1194523752 X:94950503-94950525 GTGCTTACTGCTGATGGTGTTGG + Intergenic
1194660943 X:96628020-96628042 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1194873535 X:99161175-99161197 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1196111078 X:111947860-111947882 GTGTTCAATGCTGATGGTGGAGG + Intronic
1196525244 X:116722891-116722913 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1196572723 X:117282924-117282946 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1196773637 X:119319711-119319733 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1197471231 X:126867066-126867088 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1197712114 X:129678760-129678782 GTGAGCACTGCTGCTTGCGCAGG - Intergenic
1197933317 X:131715848-131715870 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1198598674 X:138262583-138262605 GTGAGTACAGCTGAAGGAGCCGG - Intergenic
1198599170 X:138266250-138266272 GTGAGTACAGCTGAAGGAGCCGG + Intergenic
1199513464 X:148649139-148649161 GTGAGCCCTGCAGAGGCTGCAGG - Intronic
1199576704 X:149319437-149319459 GTGAGTACAGCTGAAGGAGCTGG - Intergenic
1200532622 Y:4357336-4357358 GTGAGTACAGCTGAAGGAGCTGG + Intergenic
1200610909 Y:5326721-5326743 GTGAGTACAGCTGAAGGAGCCGG + Intronic
1201595184 Y:15660352-15660374 TTGAGCCCTGCTGATGGTGAGGG + Intergenic