ID: 996088348

View in Genome Browser
Species Human (GRCh38)
Location 5:119326528-119326550
Sequence AATGCTTCCCTGCTGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996088348_996088355 14 Left 996088348 5:119326528-119326550 CCCCTGAGCAGCAGGGAAGCATT 0: 1
1: 0
2: 1
3: 24
4: 231
Right 996088355 5:119326565-119326587 AGAGGGTAACATGGTGAGAGAGG 0: 1
1: 0
2: 4
3: 62
4: 484
996088348_996088353 5 Left 996088348 5:119326528-119326550 CCCCTGAGCAGCAGGGAAGCATT 0: 1
1: 0
2: 1
3: 24
4: 231
Right 996088353 5:119326556-119326578 CTCCTCATCAGAGGGTAACATGG 0: 1
1: 0
2: 0
3: 7
4: 121
996088348_996088351 -4 Left 996088348 5:119326528-119326550 CCCCTGAGCAGCAGGGAAGCATT 0: 1
1: 0
2: 1
3: 24
4: 231
Right 996088351 5:119326547-119326569 CATTGCGTGCTCCTCATCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 64
996088348_996088356 20 Left 996088348 5:119326528-119326550 CCCCTGAGCAGCAGGGAAGCATT 0: 1
1: 0
2: 1
3: 24
4: 231
Right 996088356 5:119326571-119326593 TAACATGGTGAGAGAGGATATGG 0: 1
1: 0
2: 0
3: 40
4: 249
996088348_996088352 -3 Left 996088348 5:119326528-119326550 CCCCTGAGCAGCAGGGAAGCATT 0: 1
1: 0
2: 1
3: 24
4: 231
Right 996088352 5:119326548-119326570 ATTGCGTGCTCCTCATCAGAGGG 0: 1
1: 0
2: 2
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996088348 Original CRISPR AATGCTTCCCTGCTGCTCAG GGG (reversed) Intronic
900463453 1:2812331-2812353 AGTGGTTCCCAGCTGCTCACAGG + Intergenic
900635791 1:3664355-3664377 ATTGCTCACCTGCTGCTCTGAGG + Intronic
901075733 1:6553922-6553944 CCTGTTACCCTGCTGCTCAGGGG + Intronic
902550470 1:17216189-17216211 GTTGCATCCCTCCTGCTCAGAGG - Intronic
902876196 1:19342316-19342338 TAAGCCTCCCCGCTGCTCAGCGG - Intronic
903696974 1:25214872-25214894 AGTCCTTTCCTGTTGCTCAGAGG - Intergenic
903852126 1:26314107-26314129 AATCTTGTCCTGCTGCTCAGAGG + Intronic
904902550 1:33868960-33868982 CTTGCTTCCCTGCTGCTTGGAGG - Intronic
905268157 1:36769181-36769203 AAGTCTTCCCTGCAGCTCATGGG - Intergenic
905417495 1:37814210-37814232 AATGCAGCCCTTCTGCTCTGAGG + Exonic
905974072 1:42162860-42162882 AGAGCTTCCCTGCTGCGGAGGGG + Exonic
907465312 1:54631289-54631311 AATACTTCCCTGTTGATCTGGGG - Intronic
907575869 1:55525066-55525088 CCTGCTTCTCTACTGCTCAGAGG + Intergenic
907652028 1:56304276-56304298 ACTGCTTCCCTGCTGTCCTGTGG + Intergenic
908439794 1:64142272-64142294 ACAGCTTCCCTGCTGGTCAGGGG - Intronic
908786561 1:67740310-67740332 ATTTCTTCCCTGCTGATCTGGGG + Intronic
909033421 1:70568681-70568703 TATACTTCCCTGCCCCTCAGAGG - Intergenic
910254087 1:85229917-85229939 ACTGCTTCCCTCCTGCTGTGTGG - Intergenic
911837201 1:102635695-102635717 AATCAGTCTCTGCTGCTCAGTGG + Intergenic
916601127 1:166294441-166294463 AATGCTTCCCAGCTGCACCCTGG - Intergenic
917166149 1:172115408-172115430 AATGCTTTCTGGCTGCTGAGGGG - Intronic
917554312 1:176067933-176067955 TTTGGTGCCCTGCTGCTCAGAGG - Intronic
917799675 1:178559430-178559452 AATACTTCCCTGTTGATCAGTGG + Intergenic
918298310 1:183178933-183178955 ATTGCTTACCTGCTGCAGAGGGG + Intergenic
922336681 1:224623879-224623901 AAGGCTTGTCTGCAGCTCAGAGG - Intronic
922578130 1:226676997-226677019 GCTGCTTCCCAGGTGCTCAGGGG - Intronic
922754832 1:228089944-228089966 AATGCTACCCTGGTTTTCAGGGG - Intronic
1066802913 10:39209822-39209844 AATACTTCCCTGTTGATCTGGGG + Intergenic
1067148061 10:43707948-43707970 AATGCATCGCTGCAGCCCAGAGG + Intergenic
1067968476 10:50941794-50941816 AAGGAGTCCCTGCTGCCCAGGGG + Intergenic
1071013900 10:80971733-80971755 AATTCTGCCCTGCTGTTCTGTGG - Intergenic
1071801654 10:89069948-89069970 AATGCCTCTCTGCTTCTCAGAGG - Intergenic
1072668973 10:97415340-97415362 GATGCTTTTCTGCAGCTCAGTGG + Intronic
1072799155 10:98380793-98380815 AAGTGTTCCCTGCTGCTCTGGGG + Intergenic
1072915261 10:99533743-99533765 ACTGCTGCCCTGATGCTGAGAGG + Intronic
1074919936 10:117997864-117997886 AATGCTTCCCTACTGCTTATAGG - Intergenic
1074925245 10:118062417-118062439 TGTGCAGCCCTGCTGCTCAGAGG + Intergenic
1077331933 11:1987661-1987683 AAGGCCTTCCTGCTGCTCAGAGG + Intergenic
1078766027 11:14299471-14299493 AATGGCTCCCTGCTGCTTACAGG + Intronic
1078931148 11:15912893-15912915 CAGGCTTTCCTGCTGCTCAAGGG - Intergenic
1082434493 11:52717442-52717464 AATGCTTCCCTGTAGTTCTGGGG - Intergenic
1083772758 11:64877765-64877787 ACTGCGGCCCTGCTGCTGAGGGG + Intronic
1084279259 11:68076509-68076531 TATGCTCCCCTGCTCCCCAGGGG + Intronic
1085283128 11:75343762-75343784 AAGCCTTCTCTGCTGCTCTGGGG - Intronic
1085732041 11:79008158-79008180 CATGGTTCCCTGGTACTCAGAGG + Intronic
1086775947 11:90833121-90833143 AATGCCTGACTTCTGCTCAGAGG + Intergenic
1087980563 11:104608459-104608481 AATGCTTCTCTGCTACTACGTGG + Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1090429458 11:126634027-126634049 CATCCTTCCCTCCTGCTCTGGGG + Intronic
1202814914 11_KI270721v1_random:42837-42859 AAGGCCTTCCTGCTGCTCAGAGG + Intergenic
1091685044 12:2555541-2555563 AATGTTTCCCAGCTGCTAATTGG - Intronic
1091694950 12:2622220-2622242 AATGCTGCCCTGCTGTCCAGAGG + Intronic
1092888636 12:12948066-12948088 AATGCTTGCCTGCTACTTTGTGG + Intronic
1094540972 12:31363005-31363027 CATGCTTGCCTGGTGCTCAAGGG + Intergenic
1095984487 12:47990460-47990482 AGTGCTTCCTGCCTGCTCAGGGG + Intronic
1099519450 12:83642366-83642388 GCTGCTTCCCTGCTGCTGGGTGG + Intergenic
1099666823 12:85641843-85641865 TATGATTCCTTACTGCTCAGGGG + Intergenic
1100671422 12:96817061-96817083 AATTCTTACCTGCAGGTCAGCGG + Intronic
1101514768 12:105424619-105424641 AATCCTTCCCTTCTGCTCTTGGG + Intergenic
1102023726 12:109701232-109701254 AATGCTGCCCAGCTGCTCTGGGG - Intergenic
1103420612 12:120779305-120779327 AGTGTTTCCCTGCAGCTCTGGGG - Intronic
1103641337 12:122355048-122355070 CATGCTTCTCGGCTCCTCAGTGG + Intronic
1103710643 12:122910080-122910102 AATGTTGCCCAGCTACTCAGTGG - Intergenic
1104963613 12:132499363-132499385 AACCCTTCCCTGCTGGCCAGCGG - Intronic
1105210305 13:18253417-18253439 TATGCTGCTCTGCTGCTCACAGG + Intergenic
1105596819 13:21846848-21846870 AGTGCCTGCCTGCTGCTCTGGGG + Intergenic
1106362995 13:29049776-29049798 GCTGCCTCCCTGCTGCTCTGTGG - Intronic
1113000466 13:105630208-105630230 AGTGCTTCCCTGATGCTAGGTGG + Intergenic
1113317365 13:109196494-109196516 AATGCTTTTCTGGTGTTCAGAGG + Intronic
1115343997 14:32322688-32322710 AATGTTTCATTGCTTCTCAGTGG + Intergenic
1117105561 14:52394448-52394470 AATGTGTGCCTGGTGCTCAGAGG - Intergenic
1118370229 14:65131331-65131353 AATGCTCGCCTGCTGCTCTATGG + Intergenic
1121212969 14:92222922-92222944 AATGCCTCACTGCTGCTCAGAGG - Intergenic
1121311147 14:92935729-92935751 AAGGGGTCCCTGCAGCTCAGAGG - Intergenic
1121336879 14:93082985-93083007 ACAGGGTCCCTGCTGCTCAGCGG - Intronic
1121823260 14:96988949-96988971 AATGCCTTCTTTCTGCTCAGGGG + Intergenic
1121990129 14:98549127-98549149 AAGGATTCCCTCTTGCTCAGGGG + Intergenic
1122128414 14:99591511-99591533 AAGGCTGCCCTGCACCTCAGAGG + Intronic
1123880836 15:24676402-24676424 GATGCTTCTCCGCTGCTAAGGGG - Exonic
1124689237 15:31807945-31807967 GAAGCTTCCCTGCTGCTGATAGG + Intronic
1124700726 15:31909712-31909734 GAAGCATCCCTGCTGCTCAGCGG + Intergenic
1125418156 15:39474756-39474778 AATGCTAGACTGCCGCTCAGTGG - Intergenic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1128307616 15:66610253-66610275 AGTGCCTCTGTGCTGCTCAGGGG + Intronic
1129530040 15:76258376-76258398 GATGCTTCCCTGCAGCTGACCGG - Intronic
1130398755 15:83529691-83529713 GCAGCATCCCTGCTGCTCAGTGG + Intronic
1131125000 15:89852458-89852480 ACTGTTTCCAAGCTGCTCAGTGG + Intronic
1135755849 16:25097405-25097427 ACTCCTTCCCTTTTGCTCAGAGG + Intergenic
1136515804 16:30767780-30767802 AATGTTCCCCTCCTGCACAGTGG + Intronic
1138213685 16:55184334-55184356 ATTTCTTCCCTTCTGCTCTGTGG + Intergenic
1203140365 16_KI270728v1_random:1761029-1761051 ATTGCTTTCCTGCTGCAGAGAGG - Intergenic
1142563809 17:826745-826767 ATTGCTTCCCTGGTGCTTTGTGG - Intronic
1144754157 17:17669334-17669356 CAGCCTTCCCTTCTGCTCAGTGG - Intergenic
1144826521 17:18108456-18108478 AAGCCTTCCCCGCTGCTCAGAGG - Intergenic
1146397432 17:32479972-32479994 AAAGCTCCCCAGCTTCTCAGTGG + Intronic
1148322281 17:46764716-46764738 AACGTGTCCCTGGTGCTCAGAGG + Intronic
1149559959 17:57601497-57601519 CAAGTGTCCCTGCTGCTCAGGGG - Intronic
1150464101 17:65377199-65377221 AATGCTTCCCTGCCACTTGGCGG + Intergenic
1150587312 17:66530803-66530825 ATTGCTTCCCTGCGTTTCAGAGG + Intronic
1151869418 17:76826360-76826382 AATGCTCCCCTTCCGCTCACGGG - Intergenic
1151871567 17:76840386-76840408 AATCCATCCCAGCTGCTCTGTGG + Intergenic
1151900080 17:77006536-77006558 CTTTCTTCCCTGCTCCTCAGAGG - Intergenic
1151958859 17:77394466-77394488 CCTGCTTTGCTGCTGCTCAGAGG + Intronic
1157454199 18:47811524-47811546 AATGCTTCAGTGCTCCTAAGGGG + Exonic
1157551046 18:48582151-48582173 CATGCTTCCTTGCTGGCCAGAGG - Intronic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1158053724 18:53255098-53255120 AATGCTTCCCAGCTGATCCCTGG - Intronic
1158277149 18:55780590-55780612 GCAGCTTCCCTGCGGCTCAGCGG + Intergenic
1160664923 19:321842-321864 AAGGCGTCACTGCAGCTCAGTGG + Intronic
1161245576 19:3249800-3249822 AAGGCTACACTGCTGGTCAGTGG + Intronic
1162152627 19:8656657-8656679 AATGTTTCCCTGCTGCGCCCAGG + Intergenic
1164783374 19:30911191-30911213 AATGATTCCCCGATGCTAAGCGG + Intergenic
1166294790 19:41883527-41883549 AAGGCCTCCCACCTGCTCAGTGG + Intronic
925108869 2:1316688-1316710 AATGCTGGCCTGATGCTCAAAGG - Intronic
925270970 2:2607157-2607179 AATGTTCTCCTGCTCCTCAGAGG + Intergenic
925618998 2:5772137-5772159 CGTGCTGCCATGCTGCTCAGGGG - Intergenic
925885811 2:8392888-8392910 AAGGATTCCCAGCTGCTCAGAGG + Intergenic
926259122 2:11240591-11240613 AATGGTTGCCTGGGGCTCAGAGG + Intronic
929781658 2:44961113-44961135 ATTGATTCTCTGCTGCTCTGTGG + Intergenic
929799698 2:45089013-45089035 TTTCCTTCCCTGCTGCTCTGGGG - Intergenic
932196207 2:69786191-69786213 AATGATACCCAGCTGCTCAGGGG + Intronic
932594900 2:73087750-73087772 CCTGCTTCCCTCCAGCTCAGGGG + Intronic
933704082 2:85277003-85277025 CATGCTGCCCTGCTGCTCCCCGG - Intronic
934763360 2:96868192-96868214 AATGATTTCCTGTTGCGCAGAGG - Intronic
934926780 2:98387751-98387773 GTTGCTTCCCTTCTGCTCACTGG + Intronic
935201565 2:100861201-100861223 AAGGGTTCCGAGCTGCTCAGTGG + Intronic
936268584 2:111030608-111030630 CTTGCTTCCCTGCAGCTCTGCGG - Intronic
938250249 2:129809524-129809546 AATGCTGCCATGATGCTCAAAGG - Intergenic
939882678 2:147648028-147648050 AATGCTTCACTCCAGCACAGGGG - Intergenic
940044279 2:149392530-149392552 ACAGCTTCCCTGGTCCTCAGGGG - Intronic
940046716 2:149417330-149417352 AATGGTTCCCCACTGCTCACAGG - Intronic
940254312 2:151713095-151713117 ATTGTTTCCCTCCTCCTCAGAGG + Intronic
941201448 2:162516347-162516369 AATGGGTCCCTGCTGCTGAGTGG + Intronic
945933645 2:215881334-215881356 CTTGCTTCCCTGCTTCTCTGTGG - Intergenic
946811830 2:223533691-223533713 ATTGTTTACCTGATGCTCAGAGG - Intergenic
947724880 2:232391133-232391155 ACTGCTTCTCTGCTACACAGGGG + Intergenic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1168852827 20:988307-988329 AAAGCTTCTCTGGTGCTGAGGGG + Intronic
1168959082 20:1856129-1856151 AAGGCTTCCCAGCTAGTCAGTGG - Intergenic
1170138840 20:13104930-13104952 AGTCCTTCCCTACTTCTCAGAGG + Intronic
1170512986 20:17098085-17098107 AATGTTTCCCTCCTGCTCTCAGG - Intergenic
1171241970 20:23577617-23577639 AATGCTTCCCCGTTGCTTAAGGG - Intergenic
1171311706 20:24150175-24150197 CGGGCTCCCCTGCTGCTCAGTGG - Intergenic
1171934404 20:31260127-31260149 AATAGTTTCCTCCTGCTCAGAGG - Intergenic
1173583672 20:44165704-44165726 ACTGCTTTGCTGCTGCACAGGGG + Intronic
1173683813 20:44909057-44909079 AGTGCTTCCTTGCTACTCTGAGG + Intergenic
1174821977 20:53734214-53734236 CATGCTTCCTTGCTGCTCTTGGG - Intergenic
1178522747 21:33300037-33300059 ATTGCTTCCCAGGTGGTCAGTGG - Intergenic
1178614049 21:34114874-34114896 ATGTCTTCCCTTCTGCTCAGTGG + Intronic
1179443913 21:41418348-41418370 ACAGCTCCCTTGCTGCTCAGAGG + Intergenic
1180765950 22:18345986-18346008 TATGCTGCTCTGCTGCTCACAGG - Intergenic
1180780363 22:18516392-18516414 TATGCTGCTCTGCTGCTCACAGG + Exonic
1180813079 22:18773713-18773735 TATGCTGCTCTGCTGCTCACAGG + Intergenic
1180958813 22:19753537-19753559 CAGGGTTCCCTGCTGCCCAGAGG + Intergenic
1181199256 22:21208029-21208051 TATGCTGCTCTGCTGCTCACAGG + Exonic
1181853208 22:25764791-25764813 AATGCTGCTTTGCTGCTCATGGG + Intronic
1182822301 22:33227310-33227332 AGTGGTTCCCTTCTGCACAGAGG + Intronic
1203227569 22_KI270731v1_random:86877-86899 TATGCTGCTCTGCTGCTCACAGG - Intergenic
952358783 3:32609197-32609219 AATCCTTCCCTGCTGTTCCTTGG + Intergenic
955752236 3:62194936-62194958 GATGCTTCCCTGCTGACCAAAGG - Intronic
955849021 3:63199502-63199524 AAAGCTTCCCCACTGGTCAGAGG + Intergenic
959282322 3:104360449-104360471 AATGCTTCTCTGGTGCAGAGAGG - Intergenic
960788313 3:121398823-121398845 AATATTTCCCTGCTGATCTGGGG + Intronic
960948255 3:122981738-122981760 AAGGCTTCTCCGCTTCTCAGAGG + Intronic
961752845 3:129107497-129107519 AATGTTTCCCTGGTGCTGAAAGG - Intronic
962119930 3:132550709-132550731 AATACTTCCTTCCTGTTCAGTGG - Intergenic
962407196 3:135110436-135110458 TAAGCTTCCCTGCCTCTCAGTGG - Intronic
964609141 3:158591596-158591618 TATGCTTTCCTGCAGCCCAGTGG - Intronic
967297615 3:187980564-187980586 AATGATTCCCTATTGCTTAGAGG + Intergenic
968252910 3:197238119-197238141 ACTGCTTCCTTACTGCTTAGTGG - Intronic
968981345 4:3851411-3851433 AATGCTTCCCAGCTGCTGGGAGG + Intergenic
969179007 4:5423175-5423197 AATGCTTTCCTGTTACTCATCGG - Intronic
969386036 4:6849013-6849035 AACACTTCACAGCTGCTCAGGGG - Intronic
970058953 4:12007835-12007857 AATGGTTACCTGGTGCTCTGTGG - Intergenic
970628347 4:17914577-17914599 AATGCTTCTCAGCTGCTGACTGG + Intronic
970795699 4:19910305-19910327 AATGCTATCCTGGTGCTTAGTGG + Intergenic
972683034 4:41325253-41325275 TATAATTCCTTGCTGCTCAGGGG - Intergenic
975177078 4:71300810-71300832 ACTGCTTCTCTGCACCTCAGGGG - Intronic
976528747 4:86125513-86125535 TATGCTCCCCTGCTGCTCAAGGG + Intronic
976963200 4:91003837-91003859 ATTTCTTCCCTGCCTCTCAGAGG - Intronic
978671014 4:111247153-111247175 ACTGCTTACCTCCTGCTCTGTGG - Intergenic
980574727 4:134670338-134670360 AAGAGTTCCCTTCTGCTCAGAGG + Intergenic
985015100 4:185625683-185625705 AAGGCATCTCTGCTCCTCAGAGG + Intronic
986301082 5:6478933-6478955 TCTGCTTCCTTCCTGCTCAGGGG + Intronic
990976603 5:61566394-61566416 AATGTGTCCCAGCTGCTTAGGGG - Intergenic
992695913 5:79287036-79287058 ATTGCTTGCCTGGTGCTCAATGG + Intronic
992926267 5:81590940-81590962 ATTGTTTCCCTGCGTCTCAGGGG - Intronic
995592377 5:113712948-113712970 AATATTTCCCTGCTGATCTGGGG - Intergenic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
996551310 5:124733364-124733386 AATGCTTCCAAGATGCACAGTGG + Intronic
998563509 5:143194382-143194404 AATGCTTCCCCATTGCTCATAGG - Intronic
999210599 5:149885278-149885300 AATACTTTCATGCTGCTCTGGGG - Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999783160 5:154867611-154867633 AATGCTTCCATGAAGGTCAGGGG - Intronic
1003088873 6:3084265-3084287 AATCCTTCCCAGATGCTCTGTGG + Intronic
1003418202 6:5931989-5932011 AAGGCTCTCCTGTTGCTCAGTGG - Intergenic
1006272713 6:32976482-32976504 CTTGCCTCCCTGCTGCCCAGAGG - Intronic
1006548150 6:34796732-34796754 AAGGCTGCCCTGCTGATTAGTGG - Intronic
1006597926 6:35206990-35207012 AATGCTTCACTTCTCCTCTGGGG + Intergenic
1007091709 6:39188898-39188920 CAGGCTCCCCTGCTGCTCAGAGG + Intergenic
1007296817 6:40829546-40829568 AATGCTTACCTCCTGATGAGTGG + Intergenic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1008074291 6:47129850-47129872 AATGCTACCGTTCTGCACAGAGG - Intergenic
1015871107 6:137777172-137777194 AATGCTTCCTCACTGTTCAGAGG - Intergenic
1015939060 6:138431127-138431149 AATGCTTCCGTGGTTATCAGGGG + Exonic
1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG + Intergenic
1016374798 6:143409458-143409480 CATGCTGCCCTGCTGATGAGTGG - Intergenic
1017451568 6:154559037-154559059 AATGCTTCCCTAGTACTCGGCGG - Intergenic
1019064851 6:169288226-169288248 AATGCTACCCTGCTGGACTGGGG - Intergenic
1025031529 7:55560990-55561012 CCTGCTTCCATGCTGCTTAGGGG + Intronic
1028178965 7:87693985-87694007 CATGCTCCCGTGCAGCTCAGTGG - Intronic
1028909098 7:96187911-96187933 AATGATTCGCTGCCGCTTAGAGG - Intronic
1032666740 7:134044223-134044245 ATTACTTCCCTGTGGCTCAGAGG - Intronic
1033043185 7:137937088-137937110 AAAGCTTCCCTGTTTCCCAGAGG - Intronic
1033958809 7:146886935-146886957 ACGTCTGCCCTGCTGCTCAGTGG + Intronic
1034530858 7:151695711-151695733 AACGCCACCCTGCTGCCCAGGGG - Intronic
1035101745 7:156403074-156403096 AAGGCTTCCCTGGTGATCTGGGG - Intergenic
1035344464 7:158188946-158188968 GATGCTTTCCAGGTGCTCAGTGG - Intronic
1035734548 8:1878685-1878707 AATGCCTCTCGGCTCCTCAGTGG - Intronic
1035942430 8:3917137-3917159 AGTGCTTACCTGCTGCACAGAGG + Intronic
1036432146 8:8701789-8701811 GCAGCTTCCCTGCTGCTCAGCGG - Intergenic
1039919852 8:41885667-41885689 ACTGTTTCCCTGCTGATCTGAGG - Intronic
1040459750 8:47635818-47635840 CATGCTTACCTGCTTCCCAGTGG + Intronic
1042748005 8:72128181-72128203 AATAGTTCCCTGCTGCAGAGAGG - Intergenic
1046609217 8:116405455-116405477 AATGTTTTCCTGCTGCTCCATGG - Intergenic
1046724651 8:117661223-117661245 AATGCTTATCTGCTCTTCAGTGG + Intergenic
1047028144 8:120847182-120847204 ATTTATTCCCTCCTGCTCAGTGG + Intergenic
1047693220 8:127377662-127377684 AATGCTTACATGCTGCTGTGGGG - Intergenic
1048084584 8:131162863-131162885 AATGCTTCCTTCCTCCCCAGTGG - Intergenic
1048293186 8:133195893-133195915 TTTGCCTCCCTGCTGCCCAGAGG - Intronic
1048711174 8:137212624-137212646 AAAGATTCCCTGCTGCTGATGGG + Intergenic
1049480810 8:142821601-142821623 AGCGCTTCCCTTCTGCTGAGTGG - Intergenic
1049723978 8:144137017-144137039 TCTGCTGCCCTGCTGCTCTGTGG - Intergenic
1050232458 9:3541456-3541478 AAAGCTCTCCTGCTGCTAAGGGG - Intergenic
1056032262 9:82565235-82565257 AAAGCTGGTCTGCTGCTCAGGGG + Intergenic
1056245574 9:84691756-84691778 AAACCTTCTCTGCTGCTCTGTGG - Intronic
1056884030 9:90422394-90422416 AGTGCTTCCTTGGTGGTCAGTGG - Intergenic
1057853892 9:98587438-98587460 AATCCTTCCTTGGTGCCCAGGGG + Intronic
1059328718 9:113521072-113521094 AACGCTTCCTTTCTGCTCAGTGG - Intronic
1060870568 9:127036634-127036656 AGTGCTTGCCTGCTTCTCCGTGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062606836 9:137352258-137352280 AATGCTCCCCTCCTGCTCCGAGG - Intronic
1062651659 9:137580917-137580939 AAAGCAGCCCTGCTGGTCAGGGG + Intergenic
1185555213 X:1015882-1015904 ATTGCTTTCCTGCTGCAGAGAGG + Intergenic
1187851771 X:23598168-23598190 AATTCCTCCCTGCTGATCAGTGG - Intergenic
1188611723 X:32107609-32107631 AACGATTCCCTTTTGCTCAGGGG + Intronic
1192165614 X:68826062-68826084 TATACCTCCCTGCTGCTCATGGG + Intergenic
1195066489 X:101242614-101242636 AATCATTCCCTGCAGCTTAGAGG - Intronic
1196616592 X:117773291-117773313 AAAGCTTATATGCTGCTCAGAGG + Intergenic
1197815161 X:130490610-130490632 AATGGTTCCCTGCTACTGAGAGG + Intergenic
1199965712 X:152818958-152818980 GCTGCTTCCTTGCTGCTCTGGGG - Intergenic
1200077777 X:153560173-153560195 ACTGTTTCTCAGCTGCTCAGCGG - Intronic
1200123658 X:153803160-153803182 AAAGCGTCCCTTCTCCTCAGGGG + Exonic
1202164068 Y:21968427-21968449 AATATTTCCCTGCTGATCTGGGG + Intergenic
1202227288 Y:22617937-22617959 AATATTTCCCTGCTGATCTGGGG - Intergenic
1202315834 Y:23577717-23577739 AATATTTCCCTGCTGATCTGGGG + Intergenic
1202554931 Y:26092357-26092379 AATATTTCCCTGCTGATCTGGGG - Intergenic