ID: 996097723

View in Genome Browser
Species Human (GRCh38)
Location 5:119416575-119416597
Sequence TAGCTTATGACGGCCAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996097717_996097723 24 Left 996097717 5:119416528-119416550 CCACGTTTTTGTAGGAGCTGACA No data
Right 996097723 5:119416575-119416597 TAGCTTATGACGGCCAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996097723 Original CRISPR TAGCTTATGACGGCCAGATG GGG Intergenic
No off target data available for this crispr