ID: 996103489

View in Genome Browser
Species Human (GRCh38)
Location 5:119470292-119470314
Sequence GTGTGGGCATGGTGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 2, 1: 0, 2: 4, 3: 55, 4: 585}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996103484_996103489 -10 Left 996103484 5:119470279-119470301 CCTGCAGCCTTCTGTGTGGGCAT 0: 1
1: 0
2: 2
3: 34
4: 301
Right 996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG 0: 2
1: 0
2: 4
3: 55
4: 585
996103481_996103489 16 Left 996103481 5:119470253-119470275 CCACTGAAACTAGCTGGGGTCAT 0: 1
1: 0
2: 0
3: 16
4: 146
Right 996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG 0: 2
1: 0
2: 4
3: 55
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996103489 Original CRISPR GTGTGGGCATGGTGGGATGA TGG Intronic
900181600 1:1313486-1313508 GTGAGGGCATGGTGAGGTGTGGG - Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900613723 1:3555089-3555111 GTGTTGGCCTGGTGGGATCCAGG - Intronic
901025877 1:6278469-6278491 GCGTGGGCATGGGGGGAGTAGGG + Intronic
902627024 1:17682803-17682825 GTGTGGGGTTGGTGGGGTCAGGG - Intronic
903452870 1:23466512-23466534 GTGTGTGTATGTTGGGATCAGGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
904826336 1:33276139-33276161 GGCTGGGCATGGTGGGAGGAGGG - Exonic
905474007 1:38213240-38213262 GGGTGAGGATGTTGGGATGAGGG - Intergenic
905506203 1:38481499-38481521 GTGTTGTCAGAGTGGGATGAAGG - Intergenic
905770564 1:40635629-40635651 GTGTGTGCGTGGTGGGAGGTGGG + Intronic
905861611 1:41355622-41355644 GGGAGGGCCTGGTGGGAGGAGGG + Intergenic
906055957 1:42917100-42917122 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906418117 1:45638698-45638720 GTGAGGTCAAGGTGGGAGGATGG + Intronic
906504296 1:46366569-46366591 GGCTGGGCATGGTGGCATGGTGG + Intergenic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906748397 1:48237621-48237643 GGGTGGGCATGGTGTGGTGTGGG - Intronic
906996272 1:50797459-50797481 GTGAGGCCATGGTGGGAGGATGG + Intronic
907598003 1:55737574-55737596 GGCTGGGCATGATGGGATGTGGG + Intergenic
908264175 1:62362084-62362106 GTGTGAGCATGGTGTGACGAAGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908796834 1:67838520-67838542 GTGTGGGAAGGGTGTGATGAGGG - Intergenic
909495098 1:76269410-76269432 TTGTGGCCATGCTGGAATGAGGG + Intronic
909782256 1:79561632-79561654 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
910269421 1:85377705-85377727 GTATGGGGGTGGGGGGATGAGGG - Intronic
910478798 1:87636334-87636356 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
910705168 1:90121987-90122009 GTGTGTGTATAGTGGGATGATGG + Intergenic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
912449228 1:109759173-109759195 GTGTGTGTGTGGTGGGGTGATGG + Intronic
912486911 1:110035956-110035978 GCCCTGGCATGGTGGGATGACGG + Intronic
915931012 1:160061087-160061109 GTGGGGGCATGGTGAGGGGAAGG - Intronic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
917138024 1:171806533-171806555 GGGTGGGAAAAGTGGGATGAAGG - Intronic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
920379301 1:205526541-205526563 GAGTGGGAGTAGTGGGATGAGGG + Intronic
920654608 1:207866518-207866540 AGGTGGGCAGGGTGAGATGATGG - Intergenic
922419091 1:225447488-225447510 GAGTGGGCATGCTGTGATGGAGG + Intergenic
922794948 1:228335309-228335331 GTGGGGGGATGGGGGGATGGGGG + Intronic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923961141 1:239085014-239085036 GTGGGGGCATGGTGGGAGTGAGG - Intergenic
924274500 1:242372007-242372029 GTGTGGGGAGGGTGGTAGGAGGG - Intronic
924638902 1:245814793-245814815 GTGTGTGCATGGTGGGATAAGGG - Intronic
1063942674 10:11146613-11146635 GTGTGGCCATTGGGGAATGATGG - Intronic
1064068834 10:12207701-12207723 GTGGGAGCAGGGTGGGAGGAAGG + Intronic
1064503991 10:16009631-16009653 GGGTGGGGAGGGTGGGAGGACGG + Intergenic
1065007267 10:21391473-21391495 TAATGGGCATGGTGGGAGGAGGG + Intergenic
1065777181 10:29131881-29131903 ATGTTGGGATGGTGGGATGAAGG + Intergenic
1066371737 10:34823357-34823379 GGGAAGCCATGGTGGGATGATGG - Intergenic
1068830250 10:61485817-61485839 GTGAGGGCATAGAGGGATGCTGG - Intergenic
1068840302 10:61605956-61605978 ATGTGGGCATTTGGGGATGATGG + Intergenic
1069904004 10:71721728-71721750 GTATAGACATGGTGGTATGAAGG - Intronic
1070763237 10:79038907-79038929 ATGTGGCCATGGTGGGAGGTGGG + Intergenic
1071525728 10:86357123-86357145 GTGTGGGCAGGGTGGACTGGAGG - Intronic
1071797045 10:89018724-89018746 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
1072038385 10:91585000-91585022 GTGTTGGCATTTGGGGATGAGGG + Intergenic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072874809 10:99160974-99160996 GAGTGGCCAGGGTGGGAAGATGG + Intronic
1072933860 10:99693082-99693104 GTGTGAGTAGGGTGGGAGGATGG + Intronic
1074921723 10:118021059-118021081 GTGTAGGCAGGGTGGGTTGGGGG - Intronic
1075539791 10:123302509-123302531 GTGTGTGCATGGTGGGGGTAGGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1076399933 10:130175857-130175879 CTGTGGGCATGGTGGCATCGAGG + Intronic
1076544253 10:131233796-131233818 GTGTGGCCATGTTGGGAGGTGGG + Intronic
1077138692 11:1014034-1014056 GGGTGGGCATGGAGCGAGGAGGG + Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077411387 11:2405496-2405518 GTTTGGGGAGCGTGGGATGAGGG - Intronic
1079331058 11:19533463-19533485 GTGTGGACATGGTCAGCTGATGG - Intronic
1079977292 11:27107654-27107676 GTGAGGCCTTGGTGAGATGAAGG - Intronic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1081038147 11:38176482-38176504 TTATGGGCATGGTGGGCTGAAGG - Intergenic
1083482930 11:62961242-62961264 GTGAGGACATGGTGGGAAGGCGG + Intronic
1083669847 11:64293450-64293472 GTGTGATGGTGGTGGGATGAGGG + Intronic
1084006140 11:66324685-66324707 GTGTGGGCCTGTGGGGGTGAGGG + Intergenic
1084410161 11:69002260-69002282 ATGTGGGAAGGGTGGGGTGAAGG - Intergenic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1086824169 11:91475225-91475247 GTGTGGGAATGGTTGCATGGAGG + Intergenic
1087401039 11:97667337-97667359 GTTCGGGCATGGTGGGCTGCAGG - Intergenic
1087977235 11:104565054-104565076 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1089173996 11:116535369-116535391 GGGTGGGGATTGTGGGAGGACGG + Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089489731 11:118874956-118874978 GTGAGGCCAAGGTGGGAGGATGG + Intergenic
1089984031 11:122796206-122796228 GTGTCGGCATGGTGAGAGGATGG + Exonic
1090541886 11:127715681-127715703 GTGGTGGCATGGTGGCATGGTGG - Intergenic
1090691463 11:129187376-129187398 GTGGGGGCATAGTGGGAGGCTGG + Intronic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1091334344 11:134755102-134755124 GTGTGTGCATGCTGGGGTGCAGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1093263667 12:16973311-16973333 GTGTGCACATGGTGGGATGATGG + Intergenic
1093711489 12:22334310-22334332 GTGTGTGCATGGGGGGCTGGCGG - Exonic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095620771 12:44250832-44250854 GTGTGGGCAGTGTGGGGCGAGGG + Intronic
1096149749 12:49301412-49301434 GGGTGGCCAAGGTGGGAGGATGG + Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097508679 12:60507947-60507969 CTGTGGGCATGGTGTGATGGAGG + Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098434871 12:70457930-70457952 GTGAGGCCAAGGTGGGAAGATGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098854784 12:75639926-75639948 GTGTGAGTTTGGTGGTATGAAGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1100551988 12:95654623-95654645 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552004 12:95654695-95654717 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552006 12:95654703-95654725 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552018 12:95654759-95654781 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552020 12:95654767-95654789 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552029 12:95654807-95654829 ATGTTGGAATGTTGGGATGATGG + Intergenic
1100552031 12:95654815-95654837 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552041 12:95654855-95654877 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552048 12:95654887-95654909 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552050 12:95654895-95654917 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552063 12:95654943-95654965 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552089 12:95655047-95655069 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552098 12:95655087-95655109 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552105 12:95655119-95655141 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552107 12:95655127-95655149 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552117 12:95655167-95655189 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552126 12:95655199-95655221 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552156 12:95655319-95655341 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552159 12:95655335-95655357 ATGATGGCATGTTGGGATGATGG + Intergenic
1100552165 12:95655359-95655381 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552171 12:95655383-95655405 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552181 12:95655423-95655445 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552188 12:95655447-95655469 ATGTGGGGATGTTGGGATGTTGG + Intergenic
1100552190 12:95655455-95655477 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552192 12:95655463-95655485 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552202 12:95655503-95655525 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552205 12:95655519-95655541 ATGATGGCATGTTGGGATGATGG + Intergenic
1100552207 12:95655527-95655549 ATGTTGGGATGATGGGATGATGG + Intergenic
1101833089 12:108274540-108274562 GGGTGGGCATGGTTGCTTGAAGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102311420 12:111847490-111847512 GAGTGGGCATTTTGGGATTAGGG + Intronic
1102649336 12:114427026-114427048 GCCTGTGCATGGTGAGATGAAGG + Intergenic
1103052557 12:117792899-117792921 GTGTGTGCATGTTGGTGTGAGGG - Intronic
1103052560 12:117792921-117792943 GTGTGTGCATGTTGGTGTGAGGG - Intronic
1103052574 12:117793215-117793237 GTGTGTGCATGTTGGTGTGAGGG - Intronic
1103052579 12:117793253-117793275 GTGTGTGCATGTTGGTGTGAGGG - Intronic
1103052588 12:117793356-117793378 GTGTGTGCATGTTGGTGTGAGGG - Intronic
1103254263 12:119527263-119527285 GAGGGGGGATGGTGGGAGGAGGG + Intronic
1103434635 12:120915259-120915281 GTGTGGGGAAGAGGGGATGAGGG + Intergenic
1103600288 12:122050502-122050524 TGGTGGGCATGCTGGGATCACGG - Intronic
1103812099 12:123623234-123623256 AGCTGGGCATGGTGGGATGGGGG + Intronic
1104259874 12:127172588-127172610 GAGTGTGCATGGGGGGATGGGGG + Intergenic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1104633292 12:130422759-130422781 CTGGGCGCATGGTGGGGTGAGGG + Intronic
1104672293 12:130689110-130689132 GTGTTGGCATGGAGGGGTGTGGG - Intronic
1104743053 12:131193036-131193058 GTGTGTGCATGGACAGATGAGGG + Intergenic
1104756639 12:131273684-131273706 GGGTGGGCATGGTGTGATGTGGG - Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1106350831 13:28929166-28929188 GTGGGGGAAGGGTGGGTTGAAGG + Intronic
1106370688 13:29129854-29129876 GTGGGGGCAGGGTGAGGTGAGGG + Intronic
1107445629 13:40468050-40468072 GAGTGGGGGTGGTAGGATGATGG - Intergenic
1109201325 13:59434902-59434924 TTGTGGCCATTGTGGGATAAGGG + Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110407674 13:75168771-75168793 GCGTGGGCAACGTGGGATGTGGG - Intergenic
1111445876 13:88345546-88345568 GTTTGGGCATGGCGGGCTGCAGG + Intergenic
1111982052 13:95026647-95026669 GGGAGGCCAAGGTGGGATGATGG + Intronic
1112138814 13:96614495-96614517 TGGTGGGGATGGTGGGTTGAAGG + Intronic
1112578205 13:100655931-100655953 GTCTGGACAGGATGGGATGAAGG + Intronic
1113533368 13:111045396-111045418 GTGAGGGCATGGGGTGATGGTGG + Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1115309030 14:31961064-31961086 AGCTGGGCATGGTGGCATGATGG - Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116182580 14:41553880-41553902 GAGTGTGGAGGGTGGGATGAGGG + Intergenic
1116966457 14:51020489-51020511 GCCTGGGCAGGGTGGAATGAGGG + Intronic
1117793278 14:59363471-59363493 GCTTTGGCATGGTGGGAGGAAGG + Intronic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118726506 14:68632735-68632757 GGGTGGGCATGGTGGGCCAACGG - Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119444789 14:74654145-74654167 GGCTTGGCATGGTGGGAAGAAGG - Intronic
1119972869 14:78991922-78991944 GTGTGACCCTGGTGGGTTGATGG + Intronic
1121564936 14:94902136-94902158 GTGTGTGTATGGTGGGGTGGGGG - Intergenic
1121794981 14:96727340-96727362 ATGTGGGCATGTGGGGATGTGGG + Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1125918572 15:43510774-43510796 GGGAGGGCGTGGTGGGAGGAAGG + Intergenic
1127104992 15:55604308-55604330 GGGAGGCCAAGGTGGGATGATGG + Intergenic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1128213294 15:65916946-65916968 GGGTGGGCAAGCTGGGATGTCGG + Exonic
1128378551 15:67094350-67094372 GGGGTGGGATGGTGGGATGAGGG - Intronic
1129612958 15:77074826-77074848 GTCTGGGGATGATGGGAGGATGG + Intronic
1129661903 15:77557453-77557475 GTGTGGGGAGGGTGGAATGCTGG - Intergenic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1131498222 15:92933843-92933865 GGGAGGCCATGGTGGGAGGATGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132841186 16:1979183-1979205 GGGTGGGCACGGTGGGGGGAGGG + Exonic
1133314259 16:4872465-4872487 GGGTGGGCATGGTGGGGGGGCGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133677995 16:8093663-8093685 GTGTGGAAATGGTGGGTTGATGG - Intergenic
1134754718 16:16656682-16656704 GTGGTGGCATGGTGGCATGGTGG - Intergenic
1134991342 16:18702360-18702382 GTGGTGGCATGGTGGCATGGTGG + Intergenic
1135406695 16:22203561-22203583 GGGAGGCCAAGGTGGGATGATGG - Intergenic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135734956 16:24923483-24923505 GGCTGGGCGTGGTGGGATGATGG + Intronic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136102175 16:28004253-28004275 GTGTGGGCATCCAGGGATGCTGG + Intronic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1139527614 16:67526439-67526461 GGGTGGGCATGGTAGGGGGAGGG + Intronic
1140562455 16:75999014-75999036 GTTCGGGCAAGGTAGGATGATGG + Intergenic
1140730355 16:77850744-77850766 GTATTTGCATGGTGGGATGCCGG - Intronic
1140961455 16:79916857-79916879 ATGCGGACAGGGTGGGATGAAGG + Intergenic
1141225458 16:82110787-82110809 GTGTGGGCCAGGTGGGTAGAGGG - Intergenic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141647737 16:85376508-85376530 GTGTGGGCAGAGTGGGCTGGGGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142262104 16:89047905-89047927 TTGGGGGCCTGGTGGGGTGATGG + Intergenic
1142495794 17:305679-305701 GTGTGGGCGTGGTGGGAGAGTGG - Intronic
1142861356 17:2763918-2763940 GTGTGTGCCCGGTGGGATCAAGG + Intergenic
1143249391 17:5511618-5511640 GTGAGGACTTGCTGGGATGAGGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143698292 17:8637191-8637213 GTGGGAGCAGGGTGGGAGGAGGG + Intergenic
1143724346 17:8835214-8835236 GTATGGGCATGCAGGGACGAGGG + Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144731453 17:17528665-17528687 GGGGGGCCAGGGTGGGATGAGGG - Intronic
1144998759 17:19288950-19288972 GTATGGGCAAGGTGGGAGCAGGG + Intronic
1146695245 17:34903915-34903937 GTGGGCGCAAGGTGGGGTGAAGG + Intergenic
1146742841 17:35301447-35301469 GTGTGAGCTTGGTGGGGGGAGGG + Intergenic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146838042 17:36127869-36127891 GTATGTGCAGGGTGGGAAGATGG + Intergenic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147661585 17:42119868-42119890 GGGTGGGCATGGTGGTAGGGAGG - Intronic
1147884388 17:43675061-43675083 CTGTGGGCATGATAGGATGATGG + Intergenic
1148243486 17:46014969-46014991 GTGAGGGGATGGTGGGGGGATGG + Intronic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1149775169 17:59351529-59351551 GTGTGCCCAGGGTGTGATGAAGG + Intronic
1150035589 17:61792665-61792687 GTGTGGGCGTGGTGTGGTGGAGG + Intronic
1150626091 17:66842089-66842111 GTGAGGGCATGGTGGGCAGTGGG - Intronic
1151013760 17:70531102-70531124 GGGTGGGGATGGTGGGGTGGAGG + Intergenic
1151013802 17:70531188-70531210 GGGTGGGGATGGTGGGGTGGAGG + Intergenic
1151326504 17:73383198-73383220 GCTTGGCCATGGTGGGAGGATGG - Intronic
1151338796 17:73456545-73456567 GTGTGGGCATGCTGAGAGAATGG + Intronic
1151702517 17:75750900-75750922 GTCTGGGCATGCTGGCATCAGGG - Intronic
1151840618 17:76615019-76615041 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
1151962564 17:77414680-77414702 GGGAGGCCATGGTGGGAGGATGG - Intronic
1152462852 17:80450379-80450401 GCGTGGGCCGGGTGGGAAGAGGG - Intergenic
1152677200 17:81647794-81647816 GTGTGGCCATGGAAGGGTGAAGG + Intronic
1153554531 18:6297174-6297196 GTGGGGACATGGTGAGTTGATGG + Intronic
1154279285 18:12988439-12988461 GGGAGGCCAAGGTGGGATGATGG - Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155017910 18:21863641-21863663 GAGTGGGCAGGGTGGGCTGTGGG + Intronic
1156310018 18:35913231-35913253 GTGTGTGTGTGGTGGGATGGGGG - Intergenic
1157267046 18:46234631-46234653 GTGTGGGCATGAGGGACTGAGGG - Intronic
1158122816 18:54068972-54068994 GTTTTGGCAAGGTGGGATAATGG - Intergenic
1159912373 18:74158277-74158299 GTGTGGGAATCATGGGATGTGGG + Intronic
1159970600 18:74647751-74647773 GTGTGGGCATGGTGACAAGGTGG + Intronic
1160025875 18:75215796-75215818 GTGTGTGCAGGGTGGTAGGAGGG - Intronic
1160673051 19:375479-375501 GTGTGGGCTTGGTCGGTTGGCGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1162184454 19:8894195-8894217 GTGGGGCCAGGGAGGGATGATGG + Exonic
1162762346 19:12896239-12896261 GTGTGGGCTCGGTGTGAAGATGG + Exonic
1162902866 19:13805629-13805651 GTGGAGGCATGGATGGATGATGG + Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163072230 19:14853832-14853854 GTGTGTGCAAGGTGGAAGGAAGG + Intergenic
1163234464 19:16022769-16022791 GTGTGGGCAGGAGGGGATGCAGG - Intergenic
1163690538 19:18736106-18736128 GCGTGGACATGGGAGGATGAAGG + Intronic
1163797056 19:19343762-19343784 GTGGGGGCACGGTGGGCTGGGGG + Intronic
1164458645 19:28429253-28429275 GTGTGGCCATGGCGGGGTGGAGG - Intergenic
1164485812 19:28654888-28654910 TTGTGGGCACAGTGGAATGACGG - Intergenic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1164575273 19:29402104-29402126 GAGGGGTCATGGTGGGAGGAAGG - Intergenic
1164853511 19:31503271-31503293 GTGGAGGCACGGTGGGATGCCGG - Intergenic
1165148833 19:33749430-33749452 GTGGGGAGATGGGGGGATGATGG - Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149793 19:33753796-33753818 GTGTTGGGATGGTAGGAGGATGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1166104166 19:40589440-40589462 GTGGGGTCAGGGTGGGATGGGGG + Intronic
1166538458 19:43590954-43590976 GTCTGGGCATGGTGGGCTCTGGG - Exonic
1166794238 19:45416743-45416765 GGCTGGGCAGGGTGGGATGGGGG + Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167189776 19:47976910-47976932 GTGTGTGCATGGTGTGGTGGAGG - Intronic
1167598134 19:50437981-50438003 GTGTGAGAATGGTGGGTTAAGGG - Intronic
1167612089 19:50512556-50512578 GTGTGGCCATGGTGACACGAAGG + Exonic
1168127012 19:54289854-54289876 GTGGGGGCATGAAGGGATGCTGG + Intergenic
1168173438 19:54606606-54606628 GTGGGGGCATGAGGGGATGCTGG - Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
925368417 2:3326446-3326468 AGGTGGGCATGGTGGGAGCAGGG - Intronic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926310978 2:11676033-11676055 GTGCTGGCATGGTGGGGTGCTGG - Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
927454932 2:23241234-23241256 GTGTGGGCTTGGTGGAATGGTGG + Intergenic
927553211 2:24016532-24016554 GTGTGGGAAGGCTGGGCTGAAGG + Intronic
927651280 2:24915063-24915085 GCATGGGCATGGGGGGATAAGGG + Intronic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
929205886 2:39292422-39292444 GTATGCACATGGTGGGATCAGGG - Intronic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
930206079 2:48587702-48587724 CTGTGGGCCTGGTGATATGACGG - Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931283905 2:60816943-60816965 GTGTGGCCATGGAGAGATCAGGG - Intergenic
931477105 2:62599686-62599708 GTTGGGGCATGGTGGGGTGAGGG - Intergenic
932361810 2:71115149-71115171 GTGGGGCCAAGGTGGGAGGATGG + Intronic
933423368 2:82080115-82080137 GTGTGTGCATTGTGGGGTGGGGG + Intergenic
933629442 2:84639142-84639164 CTGTGGGCATGGTGGGGTGGGGG + Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
935325188 2:101929295-101929317 GTGTGGGGACGGTGGCATGCCGG + Intergenic
936160338 2:110079956-110079978 GTGTGGGCAGGCTGGGAGGTAGG + Intergenic
936184326 2:110291398-110291420 GTGTGGGCAGGCTGGGAGGTAGG - Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936461080 2:112714132-112714154 GGGTGGGCATGCTGGGACCAGGG - Intergenic
936522648 2:113220714-113220736 TTGTGTGCATGGGGGGCTGAGGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936674856 2:114702992-114703014 GGGTGAGCAGGGTGGGAAGAAGG + Intronic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937277474 2:120694676-120694698 GTGTGGGCGTGGGGGGATGCTGG - Intergenic
937867174 2:126761253-126761275 GTTTGAGCAGGCTGGGATGAGGG - Intergenic
937887704 2:126911407-126911429 GTGAGGGTGTGGTGGGGTGAGGG - Intergenic
938090242 2:128426505-128426527 GTGTGGGGAGGATGGGAGGAGGG - Intergenic
938924662 2:136028205-136028227 CCGTGGGCATGGTGGGCCGAGGG + Intergenic
939005811 2:136785421-136785443 GTGTGGGGACAGTGAGATGAGGG + Intronic
940293889 2:152102556-152102578 GGGTGGCCAAGGTGGGAGGATGG - Intergenic
941112730 2:161434211-161434233 GTGTGTGCATGGTGGGAGGCAGG - Intronic
941328142 2:164143395-164143417 GAGTGGGCATGGTGGGCCCATGG + Intergenic
941483511 2:166048345-166048367 GAGTGTGCAAGGTGGGAAGAGGG - Intronic
941491982 2:166153837-166153859 GGGTGGCCAAGGTGGGAGGACGG + Intergenic
941650196 2:168084172-168084194 AGGTGGGCATGGTGGGGGGAAGG + Intronic
941695406 2:168545887-168545909 GTGTGGGAAGGGGAGGATGAGGG + Intronic
942127137 2:172838331-172838353 GTGTGATCATGGTGGTATAATGG - Intronic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
944510160 2:200456656-200456678 GTGTGGGGTTGGTGGAATGGTGG - Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946299655 2:218814783-218814805 GTGTGGGCAGGGAGGGGTGGAGG + Intronic
946818440 2:223605268-223605290 GAGTGTGGATGGTGGGAGGAGGG - Intergenic
946905385 2:224411032-224411054 GTGGGAGCCTGGTGGAATGAAGG + Intergenic
946929171 2:224655551-224655573 GCTTGGGCATGGTGGGCTGAAGG - Intergenic
947208767 2:227686421-227686443 GGGAGGCCATGGTGGGAGGATGG - Exonic
947505596 2:230706127-230706149 GTGTGGGTAGGGTGGAAGGATGG + Intergenic
948144910 2:235701395-235701417 GGGTGGGCATGGTGGCATCTTGG + Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
948787266 2:240359135-240359157 GTCTGGGCCTGGTGGCATGAGGG - Intergenic
948886444 2:240887444-240887466 GTGTGGGCAGGGTGCGGTGAGGG - Intronic
1169025668 20:2369158-2369180 GGGTGGGCAGGGTGGGGGGAGGG - Intergenic
1169700576 20:8442368-8442390 GTCCTGGCATGGTGGGATGTGGG + Intronic
1170728316 20:18948974-18948996 GTCTGGCCATGGTGGGAGGATGG + Intergenic
1170910620 20:20563653-20563675 ATGTGGGCATGATAGGATAAAGG - Intronic
1171295434 20:24012767-24012789 GCCTGGGCAAGGGGGGATGAGGG - Intergenic
1171813606 20:29764011-29764033 GTGTGGGCATTGTGAGAAAAAGG - Intergenic
1172215085 20:33230034-33230056 GTGTGTGTGTGGTGGGGTGAGGG - Intergenic
1173529721 20:43760054-43760076 CTGGGATCATGGTGGGATGAGGG + Intergenic
1173665602 20:44760915-44760937 ATGTGGGCAGGGGGGGATGTGGG + Intronic
1174413649 20:50352755-50352777 GTTTGGGGAGGCTGGGATGAGGG + Intergenic
1175222775 20:57426868-57426890 GTGAGAGCATAGTGGGAAGAGGG - Intergenic
1175312260 20:58020035-58020057 GTGTTGGCATGGTGTGAGGATGG + Intergenic
1175417899 20:58813617-58813639 GTGGGGACATTCTGGGATGAAGG - Intergenic
1175802323 20:61807886-61807908 CTGTGGGCCTGGCGGGATGCAGG + Intronic
1175817295 20:61889940-61889962 GTGAGTGGATGGTTGGATGATGG + Intronic
1175820454 20:61906387-61906409 TTAAGGGCTTGGTGGGATGAAGG - Intronic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1175890502 20:62313827-62313849 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890509 20:62313855-62313877 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890516 20:62313883-62313905 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1175994062 20:62804623-62804645 GGGTGGGCATCGTGGGGTGGGGG + Intergenic
1176002677 20:62840046-62840068 GTGTGGGCATGGTGCGGGCATGG - Intronic
1176070147 20:63222087-63222109 GTGTGGGCACAGAGGGATCAGGG - Intergenic
1176304235 21:5114953-5114975 GTGTGGACATGCTGGGAAGGAGG - Intergenic
1178102936 21:29289862-29289884 GTTTTCACATGGTGGGATGAGGG + Intronic
1178599767 21:33985579-33985601 GTGTGTACATGGTGTGAGGAGGG - Intergenic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179484928 21:41704108-41704130 GCGGGGGCATGGTGGGGTGGGGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179852821 21:44147077-44147099 GTGTGGACATGCTGGGAAGGAGG + Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181349482 22:22244898-22244920 GTGGGGGCAGGGCAGGATGAAGG - Intronic
1181488530 22:23246935-23246957 GTGGGTGCATGGTGGTAAGAAGG + Intronic
1181529624 22:23509832-23509854 GCGTGGGCATGGTGGATTGGAGG + Intergenic
1181929175 22:26385794-26385816 GTCTGGCCATGATGGGATGGAGG - Intergenic
1182095685 22:27623819-27623841 GTTTGGGCTTGGAGGGCTGAGGG - Intergenic
1182808216 22:33093749-33093771 GTGTGGGGGCGGTGGGATGGAGG + Intergenic
1183191826 22:36326511-36326533 GCTTGGCCTTGGTGGGATGATGG - Intronic
1183650100 22:39148857-39148879 CTGTGGGCATTCTGGGGTGATGG - Intronic
1183684185 22:39351889-39351911 GATTGGGCCTGGTGGGATGAGGG + Intronic
1184031694 22:41898859-41898881 GGGTGGGCGTGTTGGGGTGAAGG + Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185169030 22:49281475-49281497 GAGTGGGCTTGGTGGTCTGAGGG + Intergenic
1185318426 22:50189234-50189256 GTGTGGGGCAGGTGGGATGCTGG + Intronic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949879343 3:8649333-8649355 GAGCGGGCAAGGTGGGATGGTGG + Intronic
950675853 3:14554030-14554052 GTGTGTGCATGGGGAGAGGAAGG + Intergenic
950762415 3:15243789-15243811 GTGGGGGGAGGGTGGGAGGAGGG + Intronic
951588133 3:24235959-24235981 GTGGGGACAGGGTGGGGTGAGGG - Intronic
951862782 3:27272567-27272589 GTGGGGGCCTGATGTGATGAAGG - Intronic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
953184440 3:40625147-40625169 GTGTGGGGAAGGTGGGAGGCAGG + Intergenic
953714633 3:45306923-45306945 GTGCAGGCATGGTGGGCTGCAGG - Intergenic
953780538 3:45866131-45866153 GTGGTGGCGTGGTGGGAGGAAGG + Intronic
954012133 3:47650574-47650596 GAGAGGCCAAGGTGGGATGATGG + Intronic
954468470 3:50672691-50672713 GAGAGGGAATGGGGGGATGAGGG + Intergenic
954720224 3:52555262-52555284 GTGTGGGCAGAGTGGAATGATGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
956788526 3:72662398-72662420 GGGTGGGCATGATGGGGGGAGGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960157972 3:114317374-114317396 GGGTGGGCATGGGGGGTTGGGGG - Intergenic
960425751 3:117506021-117506043 GTGTGGTGGTGGTAGGATGAAGG - Intergenic
960672198 3:120164944-120164966 GTGGTGGCATGCTGGGAGGAAGG + Intronic
961524949 3:127490780-127490802 GGGTGGGCATGGTGGGGGTAGGG - Intergenic
961651407 3:128418412-128418434 GTGTGGGCATGGGGTGGTGGGGG - Intergenic
961736411 3:129004515-129004537 GTGGGGGGATGGATGGATGATGG - Intronic
961807623 3:129500736-129500758 GTGTGGGAATGGGAGGGTGAAGG + Intronic
961829520 3:129616280-129616302 GTGTGTGCATGTGGGCATGAGGG + Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
965381052 3:167988625-167988647 GTGTGTGTGTGGTGGGATGTGGG - Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
967077762 3:186019900-186019922 GTGTGCGAAAGGTGGGAGGAGGG + Intergenic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967915130 3:194572982-194573004 GTGTGGGCAAGGTGGGCGAAGGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968074732 3:195810100-195810122 GTGTGGCCAGGGTGGGGTGGGGG + Intronic
968588724 4:1446993-1447015 GCGAGGGCTTGGTGGGATGTTGG - Intergenic
968650282 4:1757703-1757725 GTGGGGGGATGGGGGGATTATGG - Intergenic
969121041 4:4911354-4911376 GTGTGGGCATGGTTGGGTCCTGG - Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969375946 4:6763320-6763342 GTGTAGGCATCTTGGGAGGAAGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971823372 4:31588759-31588781 GTGAGGGCGTAGTGGAATGAGGG - Intergenic
972060231 4:34860473-34860495 GTGTCAGCATGGTGGGATACAGG - Intergenic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973053184 4:45620290-45620312 GTGCAGGCCTGGTGGTATGAAGG - Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
974523960 4:63023842-63023864 GAGGGTGGATGGTGGGATGAGGG + Intergenic
976933468 4:90598900-90598922 GTGAGAGCATGGTGCAATGATGG + Intronic
976936867 4:90646947-90646969 GTGTTGGGGTGGGGGGATGAGGG - Intronic
978896793 4:113898236-113898258 GGGTAGCCATGGTGGGAGGATGG + Intergenic
979195647 4:117917152-117917174 GGGTGGGGAAGGTGGGTTGAGGG - Intergenic
980437070 4:132791106-132791128 GTGTGGGGCTGGTGGGGTAATGG - Intergenic
980845003 4:138313599-138313621 GTTTGAGCATGGAGGGTTGAAGG - Intergenic
981884311 4:149654422-149654444 GTGGGGGCATGAGGAGATGAGGG - Intergenic
983755886 4:171335126-171335148 GAGGGGGCAGGGTGTGATGAAGG + Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985861836 5:2477621-2477643 GAGTTGGCCTCGTGGGATGATGG - Intergenic
985976208 5:3420513-3420535 GTGGGGTCATGGGGGGATGGTGG + Intergenic
985976252 5:3420654-3420676 GTGGGGTCATGGGGGGATGGTGG + Intergenic
986052633 5:4104470-4104492 GCCTGGGCAGGGTGGGATAAGGG + Intergenic
986177401 5:5364029-5364051 GCGCTTGCATGGTGGGATGAAGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987084442 5:14455971-14455993 GCTTGGGCATGGTGGGCTGCAGG + Intronic
987099212 5:14577505-14577527 GTTGGGGCATGGTGGGCTGCAGG - Intergenic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
988035551 5:25823422-25823444 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
989559705 5:42836623-42836645 GCTTGGGCATGGTGGGCTGCAGG - Intronic
991192353 5:63889237-63889259 GTGTGGGGATGGTTTCATGATGG - Intergenic
991240875 5:64458705-64458727 GTGTGGCTATGGTGGGATGCTGG - Intergenic
992552959 5:77876585-77876607 GTGAGGACATTGTTGGATGAAGG + Intergenic
992910785 5:81394146-81394168 GAGCGGGCATGGTGGGGTGTCGG - Intronic
993167066 5:84370383-84370405 GTGACTGCATGGTGGGAGGAGGG + Intronic
993481391 5:88429293-88429315 GTTTGGGAAAGGTGGGATTATGG - Intergenic
994570326 5:101506282-101506304 GTGTGGGCATGGTGGGCTGCAGG - Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996131061 5:119780984-119781006 GTGTAGGGGTGGTGTGATGAAGG + Intergenic
997265781 5:132494605-132494627 GTGTGTGCATGGTGACATGTTGG - Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998402045 5:141853208-141853230 CTGGGGCCATGGTGGGATGGGGG - Exonic
999750331 5:154623845-154623867 AAGTGGGCATGGTGGGGTGGGGG - Intergenic
999809596 5:155115056-155115078 GCTTGGGCATGGTGGGCTGCAGG - Intergenic
1001683045 5:173572747-173572769 GTGTTGTCATGGGGGGATGTGGG + Intergenic
1001866108 5:175106953-175106975 GAGTGGACATGGTGGGTAGAGGG - Intergenic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002179806 5:177425552-177425574 GTGAGGGCAGGGTGAGATAAAGG - Intronic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002363255 5:178690424-178690446 GTGGGGGGATGGGGGGATGCTGG - Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1003624329 6:7727994-7728016 GTGTGGCCATCCTGGGAAGAGGG + Intronic
1004090335 6:12494366-12494388 CTGTAGGCAAGGTGGCATGAAGG - Intergenic
1005943711 6:30580533-30580555 GTTGGGGCAAGGTGGAATGAGGG + Intronic
1006676918 6:35771258-35771280 GTGTGGGCAGGGTGGCAGCACGG + Intergenic
1007603298 6:43097261-43097283 GTGGGGGCAGGATGGGGTGAGGG - Intronic
1007691308 6:43703166-43703188 ATGGGGGCACGTTGGGATGAGGG + Intergenic
1007761324 6:44135223-44135245 ATGTGGGCATGGGGGCATGAGGG + Intronic
1008907630 6:56697073-56697095 GGGTGGGCTTGATGGGATGGTGG - Intronic
1009195611 6:60680778-60680800 GTGTGAGCATGGTAGTATGATGG + Intergenic
1009290507 6:61875168-61875190 GTGTGGGCGTGGTGGGGGCAGGG + Intronic
1009739308 6:67723308-67723330 GTTCGGGCATGGTGGGGTGCAGG - Intergenic
1009832891 6:68961465-68961487 GTGTGGGGATGGTGTCATGGAGG + Intronic
1011077814 6:83456400-83456422 GTGTCAGCATGGTGGGATCCAGG + Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011436960 6:87348572-87348594 GTGTGGACTGGGTGTGATGAGGG + Intronic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1012131316 6:95497198-95497220 GCTTGGGCATGGCGGGATGCAGG - Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1012879300 6:104766213-104766235 TTGTGGGCATGCTTGCATGATGG + Intronic
1013187032 6:107768278-107768300 GTGTGGGAAGGCTGGTATGATGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1015177676 6:130328644-130328666 GTGTCAGCATGATGGGCTGAGGG - Intronic
1015268172 6:131309910-131309932 GTGTGGGCCTGGTTGTTTGAAGG - Intergenic
1015395154 6:132725603-132725625 GAGGGGGGATGGTGGGAGGAGGG - Intronic
1015585092 6:134768432-134768454 GTGTGGGAAAGATGAGATGATGG - Intergenic
1015821609 6:137267062-137267084 GTGTGGTGATGTTGGGATGTGGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016660270 6:146570073-146570095 GTGTAAACATGGTGGAATGATGG - Intergenic
1018595802 6:165479232-165479254 GTGTAGGCAGGGGAGGATGATGG - Intronic
1018638802 6:165888181-165888203 GTTTGGGAATGCTGGGATGGAGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018767433 6:166945135-166945157 GTGTGGACGTGGGTGGATGAGGG - Intronic
1018799261 6:167210045-167210067 TCCTGGGCATGGTGGGAGGAAGG - Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019126043 6:169840574-169840596 TTGTGGGCATGGTGTGGTGTGGG - Intergenic
1019425066 7:971085-971107 GTGGGGGCCTCATGGGATGATGG - Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020279779 7:6644274-6644296 GGGGGGGCTTGGTGGGAGGAGGG + Intronic
1020688793 7:11328939-11328961 GTGGATGGATGGTGGGATGATGG + Intergenic
1021065732 7:16170686-16170708 GCATGGGCATGGTGGGCTGCAGG + Intronic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1021780754 7:24103400-24103422 GTGTGAGAGTGGTGGAATGATGG + Intergenic
1022132795 7:27419423-27419445 GTCTTGGCATGGTGGGAAGGTGG - Intergenic
1022317654 7:29260530-29260552 GGGTGGCCATGGTGGGGCGAGGG + Intronic
1023318085 7:38961676-38961698 GAGGGTGGATGGTGGGATGAGGG + Intergenic
1023598346 7:41855933-41855955 GTGGGGGCAGGCAGGGATGAAGG - Intergenic
1025013880 7:55423237-55423259 GAGTGGGCATGGTAGGCTGCTGG + Intronic
1025921128 7:65914244-65914266 AGTTGGGCATGGTGGTATGATGG - Intronic
1026930281 7:74219886-74219908 GTGGGGGGATGATGGGGTGAGGG + Intronic
1027254853 7:76424752-76424774 CTGTGGTCATGCTGGGGTGAAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029221752 7:98995688-98995710 GTGTGTGTATGATGGGATGGGGG - Intronic
1029388627 7:100259852-100259874 GGGTGGGCTGGGTGGGAGGAGGG + Intronic
1029550180 7:101233221-101233243 GTGAGGAGATGATGGGATGAAGG - Intronic
1029747712 7:102525597-102525619 GTGGGGGCATGGGAGGGTGAGGG + Intergenic
1029765663 7:102624687-102624709 GTGGGGGCATGGGAGGGTGAGGG + Intronic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032298058 7:130660483-130660505 CTGTAGGCCTGGTGGTATGAGGG - Intronic
1032491930 7:132330236-132330258 GTAGGGACATGGTGGGAAGAAGG + Intronic
1033530022 7:142252487-142252509 GTGTGGGCATTGTGCCAGGAAGG - Exonic
1034297831 7:149990058-149990080 GTGTGGGGAGGGATGGATGAAGG - Intergenic
1035588687 8:796741-796763 GTGCGGGCATGGGGCCATGAAGG - Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037493536 8:19418130-19418152 GTGTGGGAACAGTGGCATGATGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037813143 8:22098341-22098363 GTGGGGGAAGGGTGGGTTGACGG + Intronic
1038229121 8:25684361-25684383 GTTTGGGCAGGGTGGGGTGGGGG + Intergenic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1039070923 8:33648626-33648648 GTGTGATCATGTTGGGAGGATGG + Intergenic
1039567538 8:38562083-38562105 GTGTGTGTAAGGTGGGATGGGGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040288483 8:46112330-46112352 GTGTGGCCTTGGTGGGCTGCAGG - Intergenic
1040965546 8:53077733-53077755 GCTTGGGCATGGTGGGCTGCAGG + Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042330620 8:67576798-67576820 GTGTTGGCACGGTGGGTGGAAGG + Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1042985906 8:74582652-74582674 GTCTGAGCATGGTGGCTTGAGGG + Intergenic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1043637721 8:82407367-82407389 ATTTGGGCATGGTGTGATGAGGG + Intergenic
1044701679 8:94970919-94970941 GAGAGGCCATGGTGGGAGGATGG - Intronic
1046144288 8:110137355-110137377 GTGTGTATATGTTGGGATGAGGG + Intergenic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046231031 8:111358611-111358633 GTGTGGACTTGCTGGAATGATGG - Intergenic
1047179370 8:122572528-122572550 GTGTGTGCATGGGGGCAGGAAGG + Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1048257333 8:132915114-132915136 GTGTGTGCATGTTGGGAGCAGGG + Intronic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1049064108 8:140299295-140299317 GTGTGGGCAGGGGGGGGTCAGGG + Intronic
1049182702 8:141231171-141231193 GGGTGCGGAGGGTGGGATGAAGG + Intronic
1049286690 8:141779658-141779680 GTGTTGGTGTGGTGTGATGATGG + Intergenic
1049554165 8:143274028-143274050 GTGGGGGCAGGGTGGGGGGATGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050064262 9:1742390-1742412 GTGTTGGTTTGATGGGATGAAGG - Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1051170279 9:14314178-14314200 GTGGGGGCGGGGTGGGATGGGGG + Intronic
1052683975 9:31730870-31730892 GTGTGAGCAAGGTGAAATGATGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1057721053 9:97532233-97532255 GGATGGGCCTGGTGGGGTGAGGG + Intronic
1058402721 9:104636530-104636552 GTGTGAGCATGGTGCAGTGATGG - Intergenic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1059326689 9:113507988-113508010 ATGATTGCATGGTGGGATGATGG + Intronic
1059525206 9:114984903-114984925 TTGTGGGCATCATGGGTTGAGGG - Intergenic
1059698740 9:116754905-116754927 GTGTGGGCCTGGTGGGTTACAGG - Intronic
1060214734 9:121731908-121731930 GTGTAGACATGGTGTGGTGATGG + Intronic
1060407281 9:123379149-123379171 GTGGGGGCATGGTCAGATGATGG + Intronic
1060532120 9:124353964-124353986 TTGTGGGGATGGTGGGGTGGGGG - Intronic
1060879466 9:127107951-127107973 GAGTGGGCATAGTGGGCAGAGGG + Exonic
1061076512 9:128344707-128344729 CTGTGGTCATGGTGGGTCGAGGG + Intronic
1062188211 9:135229835-135229857 GTGTGCGCACGGTGGGAGGGAGG - Intergenic
1062447782 9:136602830-136602852 GTGTAGGAATGGTGGGATGCTGG - Intergenic
1062520914 9:136957493-136957515 GTGGGTGGATGGTTGGATGATGG + Intronic
1185867909 X:3639407-3639429 GTGGGTGCATGGATGGATGAAGG + Intronic
1186269229 X:7866749-7866771 GTGTGGGCATGATGGCATGTAGG + Intergenic
1186356815 X:8799624-8799646 GTGTGGGGTTCGTGGGGTGAGGG - Intronic
1186357142 X:8800739-8800761 GTGTGGGGTTCGTGGGGTGAGGG - Intronic
1186652818 X:11579034-11579056 GTGGGGGGATGGGGGGATGGGGG + Intronic
1187431844 X:19232235-19232257 GTGAGGGCACGGTGAGAAGACGG + Intergenic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189334643 X:40163589-40163611 TTGTGGCCATGGTGGGGTGGGGG - Intronic
1189797261 X:44657159-44657181 TTGTAGGGATAGTGGGATGATGG + Intergenic
1189907359 X:45775138-45775160 GAGTGGGCAGGGTGGGAGAAAGG + Intergenic
1191164016 X:57368021-57368043 GTATGAGCATGGTGTAATGATGG - Intronic
1192463476 X:71338105-71338127 GTGTGGCCATGTTGGGAGGTGGG + Intergenic
1192619382 X:72662333-72662355 GTGTGGGGTTGGTGAAATGATGG - Intronic
1193002119 X:76574631-76574653 GTTGTGGCATGGGGGGATGAGGG - Intergenic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1194701522 X:97119879-97119901 GTGGGGGCATGGTGGGAGTGGGG - Intronic
1194858372 X:98962501-98962523 GTGTGTGCATCATGGGATGATGG + Intergenic
1196398283 X:115288969-115288991 GTGTGGGCGCTGTGGTATGAGGG + Intergenic
1196796022 X:119502587-119502609 GTGTGTGAATGCTGGGATGCAGG + Intergenic
1196926987 X:120643313-120643335 GGGAGGCCATGGTGGGAGGATGG - Intergenic
1197091081 X:122538511-122538533 TTGTGGGCATTGTGGGATATGGG + Intergenic
1197177407 X:123500507-123500529 GTGTGGCCATGCAGGGATGCTGG + Intergenic
1197295771 X:124717306-124717328 GAGTGGGCATAGGGGGATCATGG - Intronic
1197408608 X:126087592-126087614 GTGTGAGGCTGGTGGCATGATGG - Intergenic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1199464151 X:148116835-148116857 GTGTGAGCATGGTAGAATGGTGG - Intergenic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1200519679 Y:4195555-4195577 GCTTGGGCATGGTGGGATGCAGG + Intergenic
1201065448 Y:10091090-10091112 GTGTGGGCGTTGTGGGATAAAGG - Intergenic