ID: 996106519

View in Genome Browser
Species Human (GRCh38)
Location 5:119510936-119510958
Sequence CTCTGTAAGTGGGGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996106519_996106532 18 Left 996106519 5:119510936-119510958 CCATCCAGCCCCCACTTACAGAG 0: 1
1: 1
2: 3
3: 25
4: 272
Right 996106532 5:119510977-119510999 TGTGGCAGGTTGAGAATACTGGG 0: 1
1: 4
2: 4
3: 28
4: 159
996106519_996106526 0 Left 996106519 5:119510936-119510958 CCATCCAGCCCCCACTTACAGAG 0: 1
1: 1
2: 3
3: 25
4: 272
Right 996106526 5:119510959-119510981 TGGAGACTTTACCCTACCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 102
996106519_996106533 19 Left 996106519 5:119510936-119510958 CCATCCAGCCCCCACTTACAGAG 0: 1
1: 1
2: 3
3: 25
4: 272
Right 996106533 5:119510978-119511000 GTGGCAGGTTGAGAATACTGGGG No data
996106519_996106531 17 Left 996106519 5:119510936-119510958 CCATCCAGCCCCCACTTACAGAG 0: 1
1: 1
2: 3
3: 25
4: 272
Right 996106531 5:119510976-119510998 CTGTGGCAGGTTGAGAATACTGG 0: 1
1: 0
2: 2
3: 19
4: 200
996106519_996106527 4 Left 996106519 5:119510936-119510958 CCATCCAGCCCCCACTTACAGAG 0: 1
1: 1
2: 3
3: 25
4: 272
Right 996106527 5:119510963-119510985 GACTTTACCCTACCTGTGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996106519 Original CRISPR CTCTGTAAGTGGGGGCTGGA TGG (reversed) Intronic
900292259 1:1928533-1928555 CTCTGGAGGTGGGGGCAGTAGGG - Intronic
900591124 1:3460428-3460450 CTCTGTATTTGGGGGCTGTGGGG + Intronic
901055298 1:6446373-6446395 CTGTGGAGGTGAGGGCTGGAAGG + Intronic
901209480 1:7516371-7516393 CTGTGGAATTGGGGGCTGGGAGG + Intronic
901671829 1:10860644-10860666 CTCTGTACCTGGGGGTTGAAGGG - Intergenic
901760481 1:11468066-11468088 CTCTGCAAGTAGTGGCTGCAGGG + Intergenic
902202695 1:14845484-14845506 ATGAGTAAGTGGGGGATGGATGG + Intronic
903237514 1:21959799-21959821 TTCTTTAAGTGGAGGCTGGGAGG - Intergenic
904305563 1:29586418-29586440 CTCTGTCAGTAGAAGCTGGAAGG + Intergenic
904680032 1:32222627-32222649 CCCTGTGAGTGTTGGCTGGAGGG + Exonic
907285787 1:53378644-53378666 CTCTGTATGTGGTGGGTGGGTGG - Intergenic
908186157 1:61654933-61654955 GTCTGAAAGTGGGGGCAGAAAGG - Intergenic
911348379 1:96722510-96722532 GTCTGGTAGTGGGGGCGGGAGGG + Intronic
911437901 1:97886393-97886415 CTCTATGAGTGGGGGCTGGATGG - Intronic
911603058 1:99867877-99867899 CTCTGCAAGTAGGGGCTGGGTGG - Intronic
912382267 1:109254048-109254070 CTCTGAAAGTGGGGTCTGTTTGG - Intronic
912716490 1:111987497-111987519 CTCTGTGTGTGGGGGTTGGGAGG + Intronic
916446428 1:164876528-164876550 ATCTATAAGTGGGGGCGGGGCGG + Intronic
920969891 1:210734296-210734318 CCCTGCATCTGGGGGCTGGATGG - Intronic
921327831 1:214005083-214005105 CTATGGAGGTGGGGACTGGAGGG + Intronic
923291611 1:232551620-232551642 CTCTGTCTGCGGAGGCTGGAGGG - Intronic
1063381718 10:5590004-5590026 AACTGTAAGGGGGCGCTGGAGGG + Intergenic
1063434170 10:6017338-6017360 CTCTATAGGTAGGGGCTGGGTGG + Intronic
1064170190 10:13024902-13024924 GACTGTTAGTGGGGGCTAGAAGG - Intronic
1064795201 10:19004302-19004324 TTCTTTGAGTGGGGGGTGGAAGG - Intergenic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1067289202 10:44929192-44929214 CTCTGTAAGTGTGTCCTGGCAGG + Intronic
1067411815 10:46071202-46071224 CTCTGTAAGCCCAGGCTGGAGGG - Intergenic
1067449908 10:46375869-46375891 CTGGGTAAGTGGGAGCTGGCAGG + Exonic
1067587338 10:47483894-47483916 CTGGGTAAGTGGGAGCTGGCAGG - Exonic
1067634397 10:47991661-47991683 CTGGGTAAGTGGGAGCTGGCAGG - Intergenic
1073469345 10:103713173-103713195 CTCTGTAAGTTGGATCTTGAGGG - Intronic
1073641897 10:105261463-105261485 CTCTGTAAGTCTGGACTGGATGG - Intronic
1075126634 10:119705768-119705790 CTCAGGAAGTTGAGGCTGGAGGG - Intergenic
1077123902 11:924140-924162 CTCTGTGAGTGGCTGCTGGTGGG + Intergenic
1077158466 11:1101973-1101995 CTCCGTGGGTGGGGGCTGCAGGG + Intergenic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1079203373 11:18394048-18394070 CACTGTGAGTGGGAGCTGGTAGG + Intergenic
1080614016 11:33930435-33930457 CTCCTTCAGTGGGGGCTGGTAGG - Intergenic
1080899726 11:36478163-36478185 CTCTGATGGTGGGAGCTGGAAGG - Intergenic
1083898818 11:65633902-65633924 CTCTGTAAGTGGGTGCTTCCTGG + Intronic
1084154717 11:67307126-67307148 AACTGGAGGTGGGGGCTGGAGGG + Intronic
1084184633 11:67465025-67465047 CTCTGCCTGTGGGGGCGGGAGGG + Intronic
1084496862 11:69510234-69510256 CCCTGTAAGTGTGGGCAGCATGG - Intergenic
1084620933 11:70270169-70270191 CTCCGTAAGTGGGTCCTGGCGGG + Intergenic
1084925597 11:72508823-72508845 TGCTGTAAGTGGGGCCTGGTGGG - Intergenic
1085087474 11:73680020-73680042 CTCAGGAAGTGGAGGCTGCAGGG + Intronic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1089441639 11:118522620-118522642 CGCTGTAGGTGGGGCCTGGCTGG - Exonic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090456822 11:126857325-126857347 CTCTGCAAGTTGGGGCAGGCAGG - Intronic
1090514428 11:127410789-127410811 CTCTATGGGTGGGGGCTGGGAGG + Intergenic
1090524839 11:127522117-127522139 CTCTGTGAGTGGGCATTGGATGG + Intergenic
1090845366 11:130525603-130525625 GTCTGAAAGTCGGGTCTGGAAGG - Intergenic
1091046531 11:132330573-132330595 CTCTCTAACTTGGAGCTGGAAGG + Intronic
1092980180 12:13786844-13786866 CGCTGCAGGTGGGGGCTGGGAGG + Intronic
1094432031 12:30380162-30380184 CCCTGGGAGTGGGGGCTGGCTGG - Intergenic
1095545504 12:43363346-43363368 CTCTGTGAGTAGGGACTGGGTGG - Intronic
1099455858 12:82862013-82862035 CTGAGTTAGTGGGGTCTGGAAGG + Intronic
1102657612 12:114495821-114495843 CTTTGTAAGTGGAGACTGGTGGG + Intergenic
1103980996 12:124736822-124736844 CTCAGTAAGTGGTGGATGGGTGG - Intergenic
1106766877 13:32922244-32922266 TACTGGAGGTGGGGGCTGGAGGG - Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1112496010 13:99905364-99905386 CTCAGTAAATGTGTGCTGGAGGG - Intergenic
1113683439 13:112261165-112261187 CTCTGCACCTGGGGGCTGGGTGG - Intergenic
1113683456 13:112261229-112261251 CTCTGCACCTGGGGGCTGGGTGG - Intergenic
1113863934 13:113509048-113509070 CTGTGTATGTTGGGGCTGGTGGG + Intronic
1113863949 13:113509098-113509120 CTGTGTATGTTGGGGCTGGTGGG + Intronic
1113988745 13:114341313-114341335 CTCTGTAAGTGTGTGCTGAGCGG + Intergenic
1117694495 14:58345804-58345826 CCCAGGAAGTGGAGGCTGGAGGG - Intronic
1119379850 14:74221624-74221646 CTCTGGCAGTGGGGGCTGACTGG + Intergenic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121551267 14:94803108-94803130 CTCTGGAAGTGGAGGTTGCAGGG + Intergenic
1122358092 14:101136340-101136362 CTGTGCAGGTGGGGGCTGGGAGG - Intergenic
1122920212 14:104876837-104876859 TTCTGTAAGTTGGGGGTGGCAGG + Intronic
1123114822 14:105889933-105889955 GTGTGTAAGTGGTGGCAGGAAGG + Intergenic
1202833807 14_GL000009v2_random:62946-62968 CTATGTATCTGGGGTCTGGAGGG + Intergenic
1126824169 15:52532313-52532335 CACTGCAAGGGGTGGCTGGAGGG + Intergenic
1127301083 15:57654348-57654370 ATCAGTAAGAGGGGGCAGGAGGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128830132 15:70761258-70761280 CTCAGGAAGTGGGGGCAGGGTGG + Intronic
1129301248 15:74626797-74626819 CACTGTCAGAAGGGGCTGGAGGG + Intronic
1130033927 15:80341094-80341116 GTATGGAAGTGGGAGCTGGAGGG - Intergenic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1130546207 15:84858861-84858883 CTCTGTAAAGGGGGACTGAATGG - Intronic
1131677271 15:94683314-94683336 CTCTGTAAAAAGGGGGTGGATGG - Intergenic
1132882254 16:2167618-2167640 CTCTGTGAGTGGAGGCTGTCAGG + Intronic
1135415806 16:22267171-22267193 GGCTGTAACTGGGGCCTGGAGGG + Intronic
1135468800 16:22711288-22711310 CTCCTTAAGTGTGGACTGGAAGG - Intergenic
1135507266 16:23049840-23049862 CACTGTACTTTGGGGCTGGATGG - Intergenic
1136173744 16:28503806-28503828 GTCTGTTAGTGGGGGCCAGAAGG + Intronic
1138324358 16:56151584-56151606 AACTGGAAGTGGGGGATGGAGGG - Intergenic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1141727074 16:85796734-85796756 CTCAGGAGGTGGGGGATGGAGGG - Intronic
1141957837 16:87384214-87384236 CTCTGTATTTGGAGGCTGTAAGG - Intronic
1143395079 17:6587947-6587969 GTCTGTAAGTGGGGGTGGGAGGG + Intronic
1143516889 17:7424052-7424074 CTCTGTGTTTGGAGGCTGGATGG + Intergenic
1147001929 17:37369737-37369759 CTCTGTAACTGCAGGCTGGAGGG + Intronic
1147613252 17:41813431-41813453 GTTTGGAAGTGGGGGCAGGAGGG - Intronic
1150422919 17:65055519-65055541 CTAAGTAACTGGGGGCTGGCAGG - Intronic
1152778995 17:82218213-82218235 CTCAGTCACTGGGGGGTGGACGG + Intergenic
1153535206 18:6094822-6094844 CTCTGGAACTGGGGACAGGATGG + Intronic
1154402241 18:14051272-14051294 CTCTTTAAGTGGGAGCTCGGTGG + Intergenic
1155920143 18:31595562-31595584 CACTCTACGTGGGGTCTGGAGGG - Intronic
1156055400 18:32997159-32997181 CTCTGTGTGTGGGGGTAGGATGG + Intronic
1156856655 18:41790308-41790330 CTGTGTTAGTGGTGGCTGGGAGG + Intergenic
1157581619 18:48777165-48777187 CTCTGTAAATGGGGCCAGGCGGG - Intronic
1157682360 18:49616992-49617014 CTCTGTAAGTGTGAGTTGCAGGG + Intergenic
1158692922 18:59677363-59677385 TGCTGTGAGTGGGGGCTGGTCGG + Intronic
1158886135 18:61829210-61829232 CACTGTAAGGGGAGGCAGGAAGG + Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159072942 18:63646376-63646398 GGCTGAAAGTAGGGGCTGGATGG + Intronic
1159203377 18:65218444-65218466 CTCTGGAAGAGGGGGCAGAAAGG - Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1161519992 19:4718519-4718541 CCCTGCAAGTGGGGGCTGCCGGG + Intronic
1161726368 19:5931575-5931597 CTATGTGAGTGGGGGTGGGAGGG - Intronic
1161991634 19:7687494-7687516 CTCAGTAAGTGCTGGCTGGCTGG - Exonic
1162491661 19:10995974-10995996 CTCTGTAAATGGCTGCTGGCGGG + Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163522944 19:17802751-17802773 CCCTGGAAGTGGAGGCTGCAGGG - Intronic
1164391193 19:27822625-27822647 CACTGTTACTGGGGGCTGGCTGG + Intergenic
1164710334 19:30352667-30352689 CTCGGTGAGTGGTGGCTGGCAGG + Intronic
1165931743 19:39363635-39363657 TTCTGTAAATGGGGACTGTAAGG - Intronic
1166518892 19:43466100-43466122 GTCTAGAAGTGGGGGCTGGTCGG + Intergenic
1166810579 19:45512026-45512048 CTCGGGAAGTGGAGGCTGGGAGG + Intronic
1167642012 19:50687233-50687255 CTCTGTTATTGGGGGTTGGGGGG + Intronic
1202638865 1_KI270706v1_random:64746-64768 CTATGTATCTGGGGTCTGGAGGG - Intergenic
925131072 2:1494475-1494497 ATCTGTAGGTGGGGTCTGGGGGG - Intronic
925578122 2:5381441-5381463 CGCTGGAAGTGGGGCCTGGAGGG + Intergenic
926700355 2:15799407-15799429 CTCTGTGGGAGGGGGCTGGAGGG - Intergenic
927507913 2:23626648-23626670 CTCAGTAAGTGTGGGGTGGGAGG + Intronic
928115290 2:28541808-28541830 CTCGGTAAGTGGGGGCTGCATGG + Exonic
928638891 2:33277053-33277075 CTCTGTTAGGTGGGGCAGGATGG + Intronic
929815145 2:45224642-45224664 CTGTGATTGTGGGGGCTGGAGGG + Intergenic
932333159 2:70912326-70912348 ATTTGTAGGTGGGGGCAGGAAGG + Intronic
932493934 2:72137496-72137518 GTGTGTGAGTAGGGGCTGGAAGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932781031 2:74558593-74558615 CTCTGTGAGTGAGGGCTGACTGG - Exonic
934964004 2:98704055-98704077 CTCTGTAAGTAGGGTCTGTATGG + Intronic
935359588 2:102236252-102236274 AGCAGTCAGTGGGGGCTGGAAGG + Intronic
936019246 2:108982265-108982287 CTCTCCCAGTGTGGGCTGGATGG - Intronic
936078557 2:109417269-109417291 AGGTGTAGGTGGGGGCTGGAGGG - Intronic
936886895 2:117321413-117321435 CTCTGTACGAGGTGCCTGGAAGG + Intergenic
937237112 2:120437673-120437695 CTCTGTGTGTGGGGGATTGAAGG - Intergenic
937363411 2:121244411-121244433 TTCTGTGAGTGGGGGCAGGCAGG + Intronic
939397393 2:141648748-141648770 ATCTGTTAGTGGGAGCTGAATGG + Intronic
939979465 2:148761336-148761358 CTCTGTAACTGGGGGCTGGATGG - Intronic
946140348 2:217685123-217685145 GTATGTGTGTGGGGGCTGGAGGG + Intronic
946140456 2:217686112-217686134 GTATGTGTGTGGGGGCTGGAGGG - Intronic
946625381 2:221606547-221606569 CTCTGAAGGAGGGGGCTGCATGG + Intergenic
947154166 2:227144819-227144841 CTCTGAAAGTGAGACCTGGAGGG + Intronic
947723359 2:232382069-232382091 GGCTGTAGGTGGTGGCTGGATGG - Exonic
947773176 2:232687034-232687056 CTCTGAAAGTGGAGACTGGCTGG + Intergenic
948111996 2:235463758-235463780 CTCTGACAGTGGGAGCTGGCTGG + Intergenic
948217031 2:236239635-236239657 CTCTATGACTGTGGGCTGGATGG + Intronic
948438250 2:237967927-237967949 GCCTGGAAGTGGGGGCAGGATGG + Intronic
949048161 2:241881752-241881774 CCCTGTGTGCGGGGGCTGGACGG + Intergenic
1169669462 20:8080102-8080124 TTTTGTAAGTGGTGGGTGGAAGG + Intergenic
1170007324 20:11683693-11683715 CTCTGGAAATGGGACCTGGAGGG - Intergenic
1170475754 20:16712966-16712988 CCCTCTAAGTCGGGGCTGGAAGG - Intergenic
1173202223 20:40962455-40962477 CTCAGCAAGTGTGTGCTGGATGG + Intergenic
1173340368 20:42147759-42147781 CTCCCTTAGTGGGGGCTGAAGGG + Intronic
1173885178 20:46451176-46451198 CTCTGGAACAGGGTGCTGGATGG + Intergenic
1174037844 20:47679069-47679091 CTCAGGAAGTGGGGACAGGAAGG - Intronic
1176136741 20:63526106-63526128 CTCTGGAGGGTGGGGCTGGAAGG + Intergenic
1177278913 21:18952409-18952431 CTCCGAAAGTGGGAGCTGGATGG + Intergenic
1178495048 21:33079216-33079238 CTCTGCACATGGGGGCTGAATGG + Intergenic
1178930113 21:36810623-36810645 TTCTGTATGTGGGGGTGGGAGGG + Intronic
1180363094 22:11917143-11917165 CTATGTATCTGGGGTCTGGAGGG + Intergenic
1180999414 22:19981142-19981164 CTCTGTAGTTGGGGGGTGGAGGG + Intronic
1181775940 22:25160345-25160367 CTCTGAATGAGGGGGCTGGATGG - Intronic
1182422859 22:30257020-30257042 CTCTGGACATGGTGGCTGGAAGG - Intergenic
1182464630 22:30506664-30506686 CTCAGTAAGTGCTGGCTGGTAGG + Intergenic
1182544242 22:31064598-31064620 CTCTGGAGGCTGGGGCTGGAGGG - Intronic
1182738229 22:32546539-32546561 CTCGGTGGGTGGGTGCTGGAGGG + Intronic
1183619251 22:38963324-38963346 CTCTGTAAGTGAGGGTGGGCGGG - Intronic
1183872203 22:40748493-40748515 CTGTGTAAGAGGGGGCCTGAAGG - Intergenic
1184476007 22:44721815-44721837 CTCAGCAAGTCAGGGCTGGAGGG - Intronic
1185179269 22:49349899-49349921 CTCTGGGAGTGGTGGCTGGCAGG - Intergenic
949426146 3:3918327-3918349 CCCAGTAAGTGGCGGATGGAAGG - Intronic
951866619 3:27315869-27315891 GTCTCTAAATGGGGACTGGAAGG + Intronic
956604896 3:71064629-71064651 CTCTGGAAGTGGAGGCGGGGAGG - Intronic
957405455 3:79769448-79769470 ATCTGTAAGTTAGGTCTGGAAGG - Intergenic
959468854 3:106723815-106723837 TACTGTAAGTGTGGTCTGGAGGG + Intergenic
960339077 3:116453357-116453379 TTCTGTAAGTTGGGGCTAGTGGG + Intronic
961552483 3:127677204-127677226 GTCTGCAGGTGGGGGCTCGATGG - Exonic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
965866766 3:173214701-173214723 CTCTGTTAGTGGGGCATGGCAGG - Intergenic
966854997 3:184187758-184187780 CTCTGTGAGTGGGGGAAGCATGG + Exonic
967467759 3:189827355-189827377 GTCTGTAAGGGGGAGCTGGTGGG - Intronic
967929299 3:194679157-194679179 CTCGGTGAGTCAGGGCTGGAGGG + Intergenic
968017610 3:195352703-195352725 CTCTTTGAGTGTGGGCTAGATGG + Intronic
968047184 3:195631009-195631031 CTCTGTCTGTGGGGGCTGCAGGG + Intergenic
968307417 3:197658855-197658877 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307431 3:197658915-197658937 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307449 3:197658975-197658997 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307463 3:197659035-197659057 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307646 3:197659895-197659917 ATCTGTAACTGAGGGCTGCATGG - Intergenic
968430333 4:554726-554748 CTCTGCACGTGGGGCCTAGAGGG - Intergenic
968966599 4:3772091-3772113 CTCCGGGGGTGGGGGCTGGAGGG + Intergenic
969066187 4:4483453-4483475 GTTAGTAAGTTGGGGCTGGAAGG - Intronic
969442704 4:7226759-7226781 CTCCGTTGGTGGGGGATGGAAGG + Intronic
971566260 4:28145324-28145346 TTCTGGAAGTGGGGCCTGGTAGG - Intergenic
972390379 4:38607747-38607769 TTCTGTAAGTTGGGCCTGGATGG - Intergenic
973391930 4:49564290-49564312 CTATGTATCTGGGGTCTGGAGGG + Intergenic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
976142577 4:82007793-82007815 CTCAGTAAGGGAGGGCTGAAGGG + Intronic
977027804 4:91842534-91842556 CCTTATAAGTGGGAGCTGGAAGG + Intergenic
981491723 4:145346864-145346886 CTGTCTAAGTGGGTGCAGGACGG - Intergenic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
983442832 4:167809503-167809525 CTCTGGAGGTGGTGGGTGGAAGG - Intergenic
983985297 4:174052461-174052483 CTCTGTTAGTGGGGGTTGAGAGG - Intergenic
1202766215 4_GL000008v2_random:150605-150627 CTATGTATCTGGGGTCTGGAGGG - Intergenic
985519877 5:369122-369144 CCCAGCAAGTGGGTGCTGGATGG - Intronic
985544928 5:504722-504744 CTCTAAACGTGGGGGCTGAAGGG + Intronic
985691757 5:1316785-1316807 TGTTGTAAGTGGGGTCTGGAAGG - Intergenic
985708588 5:1415456-1415478 CACTGAGAGTGGGCGCTGGAAGG - Intronic
985744418 5:1638120-1638142 CCCTGTCTGTGGGGGCTGCAGGG - Intergenic
987511061 5:18839504-18839526 CCCTGTGAGAGGGTGCTGGATGG - Intergenic
990586452 5:57216133-57216155 TTCTGTGAGTGGGGGTTGGGTGG + Intronic
992810411 5:80382193-80382215 CTCTGAAAGGGTGGGCTGAAAGG - Intergenic
994761490 5:103859914-103859936 CTTTGTAAGAGGGAGCTGGGAGG + Intergenic
995740520 5:115351108-115351130 CTCTGGAGGTGGGGACTGGTGGG - Intergenic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996251654 5:121342482-121342504 CACTGGAAGTGGGGCCTGGTGGG - Intergenic
998615270 5:143733673-143733695 CTCTGTCAGTGGGGGAGGGGGGG - Intergenic
1000728334 5:164800685-164800707 CTCTTCACGTGGGGGCAGGAAGG + Intergenic
1001113617 5:168920314-168920336 CTCTGTACATGGGGGCTGCCCGG - Intronic
1001479416 5:172077492-172077514 CTCTGTAAGAAGGGACTTGATGG - Intronic
1001671194 5:173475330-173475352 CTCGGTAAGTGTGGGATGGATGG + Intergenic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1005348097 6:24910052-24910074 CCCTGTAAGAGGGAGCTAGAAGG + Intronic
1005398886 6:25411353-25411375 ATCTTTAAGTGGTGGCAGGATGG - Intronic
1006151992 6:31994634-31994656 CTCTGAAGGTGGTGGCTCGAGGG + Exonic
1006158294 6:32027372-32027394 CTCTGAAGGTGGTGGCTCGAGGG + Exonic
1006738578 6:36292180-36292202 CCCTGTATGTGGGGGAAGGAAGG - Intronic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1007291632 6:40791611-40791633 TCCTGTAAGGCGGGGCTGGATGG - Intergenic
1007503032 6:42313133-42313155 TCCTGGAAGTGTGGGCTGGAAGG - Intronic
1007729179 6:43935408-43935430 CTCAATACGTGGGGGATGGACGG - Intergenic
1012221757 6:96657644-96657666 CTCACTAAGTGTGGGCTGCAGGG - Intergenic
1016481145 6:144483548-144483570 CTCAGGAAGCGGGGGCAGGAAGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1018764794 6:166925008-166925030 CACTGTGGGTGAGGGCTGGATGG - Intronic
1018798715 6:167206729-167206751 CTCTTTAGATGGGCGCTGGAGGG + Intergenic
1019171524 6:170135930-170135952 CTCTGCGAGTGGGAGCGGGAGGG - Intergenic
1023109052 7:36791896-36791918 CTCTGTAACTCGGGGCTACACGG - Intergenic
1023164852 7:37333447-37333469 CTCTGTAGGTGGGTGCTGGTGGG - Intronic
1023810543 7:43907915-43907937 CTCTGTAAATGGGAGCTGATAGG + Intronic
1023908013 7:44535983-44536005 CACGGTCAGTGGGGGCTGGTCGG - Intronic
1024858034 7:53804533-53804555 CTCTCTAAATGAGGCCTGGATGG - Intergenic
1026607454 7:71827957-71827979 CTCTGTGTGCTGGGGCTGGAAGG + Intronic
1028122841 7:87076167-87076189 CTTTTTAAGTGGAGGCTGGTGGG + Intergenic
1028880757 7:95877111-95877133 CTCTCCAAGTGGGAGCTGGCAGG - Intronic
1029275238 7:99400026-99400048 CTCTGGAAGAGGGGAATGGAGGG + Intronic
1030483122 7:110129506-110129528 CACTGTAAGTCATGGCTGGATGG - Intergenic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1030934815 7:115572344-115572366 CTCTGCCAATGAGGGCTGGATGG + Intergenic
1032003902 7:128284964-128284986 CGCTGTCAGCTGGGGCTGGAGGG + Intergenic
1034753255 7:153590752-153590774 CTCTGTGAGTGGTGACTGCATGG + Intergenic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1034906813 7:154956349-154956371 TTCTGGAAGTGGGGAATGGAAGG + Intronic
1035452749 7:158988938-158988960 CTCAGTAAATGTGGGATGGATGG - Intergenic
1037600278 8:20387981-20388003 CTCTGCATGTGGTGGCTTGATGG + Intergenic
1037996936 8:23359544-23359566 GGCTGTCAATGGGGGCTGGAAGG - Intronic
1044251364 8:90006927-90006949 GACATTAAGTGGGGGCTGGAGGG + Intronic
1045743146 8:105386105-105386127 GCCAGTAAGTGGGGGCAGGAGGG + Intronic
1046106314 8:109671421-109671443 CTTTTTCAGTGGGGGCTGGAGGG + Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047717730 8:127611100-127611122 CTCATGAAGTGGGGGCTGAATGG + Intergenic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1049683472 8:143930107-143930129 CTCAGCAGGTGGGGGCTGGAAGG - Intronic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1050802045 9:9627536-9627558 CTCTGTAAGGTGGGGCTGGAGGG + Intronic
1051644610 9:19255158-19255180 CTCAGGAGGTGGAGGCTGGAGGG + Intronic
1052754807 9:32529788-32529810 CTCTGTTAGAGGGGGTTGAAGGG - Intergenic
1052844430 9:33322545-33322567 TTCTGTAAGTGGGAGCTTGGTGG - Intronic
1053284168 9:36839696-36839718 CTTTGAATGTGAGGGCTGGATGG - Exonic
1053913242 9:42926273-42926295 CTCTGAATCTGGGGTCTGGAGGG + Intergenic
1057291259 9:93808889-93808911 CTATGTAAGTGGGAGCAGGTGGG - Intergenic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1058564732 9:106270420-106270442 CTCAGGAAGTGGGACCTGGAAGG + Intergenic
1058835243 9:108854479-108854501 CACTGGAGGTGGGGGCTGTAAGG - Intergenic
1058907442 9:109493356-109493378 CTCTGTAAAATGGGGCTGGAAGG + Intronic
1060920762 9:127418846-127418868 CTCTGGGAGTGTGGTCTGGAAGG - Intergenic
1061294956 9:129671993-129672015 CTGAGTAGGTGGGGGCAGGAAGG + Intronic
1061698724 9:132398451-132398473 ATCTGCAAGTGCGGGCAGGAGGG - Intronic
1062012153 9:134273025-134273047 CTCTGCATGGGAGGGCTGGAGGG + Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1203794557 EBV:169697-169719 CTCTGTGCGGGGGGGCTGGGGGG - Intergenic
1203794758 EBV:170235-170257 CTCTGTGCGGGGGGGCTGGGGGG - Intergenic
1203794949 EBV:170758-170780 CTCTGTGCGGGGGGGCTGGGGGG - Intergenic
1203795150 EBV:171296-171318 CTCTGTGCGGGGGGGCTGGGGGG - Intergenic
1203546964 Un_KI270743v1:135494-135516 CTATGTATCTGGGGTCTGGAGGG - Intergenic
1185921945 X:4103187-4103209 CTCTGTAGATGGGGGTTGCATGG - Intergenic
1189917412 X:45869931-45869953 CCCTGTAAGTGGGGGGAGGAAGG + Intergenic
1192529014 X:71870558-71870580 CTCTGTCCGTGGGGTGTGGAAGG + Intergenic
1196541115 X:116909212-116909234 CTATGACAGTGGGGGCTGAAAGG + Intergenic
1198229570 X:134676256-134676278 TTCTCTCAGTGGGGGCTGGCGGG + Intronic
1199715872 X:150506976-150506998 GTCTGACAGTGGGGGCTGGGAGG + Intronic
1201950433 Y:19557887-19557909 CTCAGTATGTGGGGGAAGGATGG + Intergenic