ID: 996109989

View in Genome Browser
Species Human (GRCh38)
Location 5:119554077-119554099
Sequence AAGGGTATTCAGGATGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996109989_996109995 6 Left 996109989 5:119554077-119554099 CCGTGCCCATCCTGAATACCCTT 0: 1
1: 0
2: 1
3: 37
4: 423
Right 996109995 5:119554106-119554128 TTTCTCTTGCCTGATTGCCCTGG 0: 2637
1: 4897
2: 7635
3: 8403
4: 4607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996109989 Original CRISPR AAGGGTATTCAGGATGGGCA CGG (reversed) Intronic
900181394 1:1312574-1312596 CAGGGTATGCGGGCTGGGCAGGG - Exonic
901480587 1:9522248-9522270 AAGGAAATTCAGGCCGGGCATGG + Intergenic
901602882 1:10435862-10435884 AAGTATTTTCAGGCTGGGCATGG - Intronic
901859779 1:12066941-12066963 AAAGAACTTCAGGATGGGCACGG - Intronic
902421665 1:16285560-16285582 ATGGGAAGACAGGATGGGCATGG - Intronic
902576859 1:17383555-17383577 AAGCTTATTCAGGCTGGGCGTGG + Intronic
903429859 1:23287148-23287170 AGGGGGATTCAGGCTGGGCATGG + Intergenic
903688305 1:25149149-25149171 CTGGGGATTCAGGATGGACAAGG - Intergenic
905147733 1:35901259-35901281 AAGGCGATTCAGGCCGGGCATGG - Intronic
905495078 1:38378478-38378500 AAGAGTATACAGGCAGGGCACGG + Intergenic
907975361 1:59426352-59426374 TAGGGTATCCAGGGTGGGAAGGG + Intronic
908331481 1:63074977-63074999 ACGGGTATTGAGGATGGGGAGGG - Intergenic
908359119 1:63350249-63350271 AATTGTTTTCAGGCTGGGCATGG - Intergenic
908462128 1:64356227-64356249 AAGTGTATTGAGGATGGGTTTGG + Intergenic
908696217 1:66844900-66844922 AAGACAATTCAGGCTGGGCACGG + Intronic
908745130 1:67369270-67369292 AAGAGAATTCTAGATGGGCATGG + Intronic
909141381 1:71870168-71870190 AAAGCTATCCAGGCTGGGCATGG - Intronic
910443046 1:87272718-87272740 AAAGGTATTTAGGATGTCCAGGG - Intergenic
910943219 1:92559481-92559503 AAGAGGATTCTGGCTGGGCATGG + Intronic
910982283 1:92970714-92970736 AAGAGTAATCAGGCTGGGCGCGG - Intergenic
911196888 1:95003748-95003770 AAAGGCATTCAGGTTGGGCATGG - Intronic
911496937 1:98643244-98643266 AAGGGAATGCAGAATGGGTATGG + Intergenic
912315831 1:108667184-108667206 AAATGTATCCAGGCTGGGCATGG + Intergenic
912403495 1:109416812-109416834 ATGAGTACTCAGGTTGGGCATGG + Intronic
912715932 1:111983524-111983546 AAGGGTTGTGAGGCTGGGCAGGG + Intronic
913093920 1:115498469-115498491 GAGGGTAACCAGGTTGGGCAGGG - Intergenic
913351612 1:117867396-117867418 AAGGAAATACAGGATGGGCACGG + Exonic
915514274 1:156403708-156403730 AAAGGGATTCAGGCCGGGCACGG - Intergenic
916181337 1:162086431-162086453 AAAGCTACTCAGGGTGGGCAAGG - Intronic
916456651 1:164977787-164977809 AAGGGTGTGCAGGAAGGGGAAGG + Intergenic
916649863 1:166824643-166824665 AAGGGCATGCAGGCCGGGCACGG - Intergenic
916746548 1:167689195-167689217 AAGAATATTCAGGCTGGGCGTGG + Intronic
919694159 1:200556561-200556583 AATTGTATACAGGATGGGCCTGG + Intronic
919856317 1:201708699-201708721 AGGGGTATTGAGGAAGGGGATGG + Intronic
920158402 1:203975530-203975552 AAGAATTTTCAGGCTGGGCATGG - Intergenic
920346209 1:205307192-205307214 ATGTGTATTCAGGGTGGGGAGGG + Intronic
920356905 1:205380501-205380523 AAGCATTTTCAGGCTGGGCATGG + Intergenic
920416964 1:205805396-205805418 AGGAGTAGACAGGATGGGCAGGG + Intronic
921035741 1:211376590-211376612 AAGAGTATTCAGGCCAGGCATGG - Intergenic
921876521 1:220202650-220202672 AAGGGAATTCAGGCCGGGCATGG + Intronic
923111585 1:230894875-230894897 AAGGGTGTGCAGGCTGGGCTGGG - Intergenic
923379547 1:233401939-233401961 AATGTTATTCATGATAGGCAAGG + Intergenic
923630346 1:235645505-235645527 AAGAATGTTCAGGCTGGGCATGG + Intronic
923772710 1:236951428-236951450 AAGTGTATCCAGGCTGGGTAAGG + Intergenic
923794291 1:237138321-237138343 AAATATATCCAGGATGGGCATGG - Intronic
924306533 1:242694533-242694555 ATAAGTATTCAGGCTGGGCACGG - Intergenic
1063188691 10:3672881-3672903 AATAGGATTCAGGCTGGGCATGG - Intergenic
1063613183 10:7580408-7580430 AAGTGCATTCAGGCTGGGCATGG - Intronic
1063682937 10:8207733-8207755 AATGGGATACAGGCTGGGCACGG - Intergenic
1064797360 10:19028396-19028418 GAGGGAATGCAGGCTGGGCACGG + Intergenic
1065989364 10:30992701-30992723 AAGAAGATTCAGGCTGGGCACGG - Intronic
1066292022 10:34022964-34022986 GAGGGTATTCAGAATGGCTAAGG + Intergenic
1068228192 10:54134461-54134483 AAAGAAATTCAGGCTGGGCACGG + Intronic
1068523836 10:58106034-58106056 ATGGGTAGACAGGCTGGGCAGGG + Intergenic
1069783131 10:70969357-70969379 AAGGGGATTACAGATGGGCAGGG + Intergenic
1070096909 10:73346342-73346364 ATGTGTATTGAGGCTGGGCAAGG + Intronic
1070249535 10:74762005-74762027 AATGAGATTCAGGCTGGGCATGG + Intergenic
1070605366 10:77894655-77894677 TAGGATCTTCTGGATGGGCAAGG + Intronic
1070956737 10:80468848-80468870 AAGTGCATTCAGGCCGGGCATGG - Intronic
1071031191 10:81183290-81183312 AAAGGAATACAGGATGGGGAGGG + Intergenic
1071878386 10:89867272-89867294 AAGTGTAGTCAGGGTGGGCAAGG - Intergenic
1072062063 10:91822846-91822868 TATGGTATCCAGGCTGGGCATGG - Intronic
1072349015 10:94539809-94539831 AAAGGTATTCAGGATGCAGATGG + Intronic
1072563834 10:96601181-96601203 AAGGAAATTGAGGCTGGGCATGG + Intronic
1072793878 10:98339406-98339428 AAGGGAGTTCAGGCTGGGCGTGG + Intergenic
1072930242 10:99656225-99656247 AGGGGCACTCAGGAGGGGCATGG + Intergenic
1073081232 10:100862281-100862303 AAGGGCATTCCAGACGGGCAAGG - Intergenic
1074374549 10:112928464-112928486 AAGGATTTTTAGGAAGGGCATGG + Intergenic
1074508913 10:114095441-114095463 AAGGGTAACCAAAATGGGCAGGG + Intergenic
1074524129 10:114249882-114249904 GAGGGGACTCAGGATGGCCACGG - Intronic
1074688192 10:115979115-115979137 AAATGCACTCAGGATGGGCATGG + Intergenic
1075216482 10:120540637-120540659 ATAGTTATTCAGGATGTGCAGGG - Intronic
1075501903 10:122982467-122982489 ATGGGGTTTCATGATGGGCAAGG + Intronic
1076632994 10:131863180-131863202 AGGGTCATTCAGGCTGGGCACGG + Intergenic
1076811131 10:132886900-132886922 AAGGGTGTGCAGGCTGGGCTGGG - Intronic
1077182893 11:1224433-1224455 AAGGGCAGTCAGCCTGGGCAGGG + Intronic
1078220165 11:9345140-9345162 AAGTGCATTTAGGCTGGGCATGG + Intergenic
1078460172 11:11509090-11509112 CAGAGGATTCAGAATGGGCAAGG - Intronic
1078504010 11:11916156-11916178 AAGGATGTGCAGGCTGGGCATGG + Intronic
1079116959 11:17646103-17646125 AAAGGGAGCCAGGATGGGCAGGG - Intronic
1079967264 11:26994503-26994525 CTGGATATTCAGGATGGCCAGGG - Exonic
1080249742 11:30219675-30219697 ATGGGTATTTTGGCTGGGCATGG - Intergenic
1082293826 11:50413605-50413627 AAGTTTCTTCAGGCTGGGCAAGG - Intergenic
1082664681 11:55961286-55961308 ATGTGTATTCAGGCTGGGCACGG + Intergenic
1082785965 11:57316843-57316865 AAGGGTTTGCAGGAGAGGCATGG - Intronic
1083185866 11:61017548-61017570 AAGGTGAGTCAGGATGGGAAGGG + Exonic
1085296869 11:75436319-75436341 AAGGGCATTCCAGGTGGGCACGG - Intronic
1085425247 11:76398749-76398771 AATTGAATTCAGGCTGGGCATGG - Intronic
1086226923 11:84522830-84522852 AAAGATAATCAGGATGTGCAAGG - Intronic
1086346933 11:85906355-85906377 AAGTGAATTGAGGCTGGGCAAGG - Intronic
1086389776 11:86351219-86351241 AAGAGTATTCAGGCCGGGCGCGG - Intergenic
1086574925 11:88329189-88329211 AAGCCTATTCAGGCTGGGCGTGG + Intronic
1086944321 11:92830120-92830142 AAGGGTATTTAGGATCAGAATGG + Intronic
1087097760 11:94336223-94336245 AAGCATATTCAGGCCGGGCATGG - Intergenic
1087700528 11:101431712-101431734 AGGGAAATTCAGGCTGGGCACGG - Intergenic
1088120662 11:106365165-106365187 GAGGGTCTTCAGGCTGGGCACGG + Intergenic
1088194808 11:107262565-107262587 TAGGGGATTGAGGATGGGGAAGG + Intergenic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1088735332 11:112723744-112723766 AAGGGGAGGGAGGATGGGCAGGG + Intergenic
1089096142 11:115921683-115921705 CAAGGTATCCAGGATGTGCATGG + Intergenic
1089872792 11:121691499-121691521 AAAAGTATTCAGGCTTGGCATGG - Intergenic
1091500952 12:1017285-1017307 AAGAATATTCAGGACGAGCATGG - Intronic
1091905306 12:4181635-4181657 AGGGCTATTCAGGCCGGGCACGG - Intergenic
1092366963 12:7884208-7884230 AAGGAAATTCAGGCTGGGCGCGG - Intronic
1092826132 12:12400717-12400739 AAGGATATAAAGGATGGGGAGGG - Intronic
1093438312 12:19163469-19163491 AAGTGAATTCAGGCTGGGCGCGG - Intronic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1094409146 12:30150632-30150654 AAGGCTATTCTGGCTGGGCGTGG - Intergenic
1094636444 12:32231190-32231212 AAGCGTATTTAGGCTGAGCATGG + Intronic
1094645558 12:32320349-32320371 AAAGGTTTTGAGGCTGGGCACGG + Intronic
1096652196 12:53067372-53067394 GAGGGTCTGCAGGAAGGGCACGG + Intronic
1097793080 12:63835292-63835314 AAGGGATTTCAGGCTGGGCGTGG + Intergenic
1097865627 12:64557139-64557161 AAGGGAATTTAAGATGGGCAGGG - Intergenic
1097929021 12:65163956-65163978 AAAGGTATTCAAGATTGGTATGG + Intergenic
1098022516 12:66170483-66170505 AAGTGTGTTCAGGCTGGGCGCGG - Intergenic
1099954652 12:89341685-89341707 AGGGTTATACAGGTTGGGCATGG + Intergenic
1100834785 12:98556028-98556050 AAAGACATTCAGGCTGGGCACGG + Intergenic
1101024510 12:100587760-100587782 AAGGGCATCCAGGCTGGGCGCGG + Intronic
1102927235 12:116835632-116835654 AAGGGTTATCAGGGTGGGCTGGG + Intronic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1105333214 13:19437533-19437555 AAGAGTTGTGAGGATGGGCAAGG + Intronic
1105339954 13:19512865-19512887 AAGTGTTTTCTGGCTGGGCATGG - Intronic
1105842150 13:24263557-24263579 AAGTATATGGAGGATGGGCATGG - Intronic
1105878495 13:24582259-24582281 AAGAGTTGTGAGGATGGGCAAGG - Intergenic
1105921357 13:24966834-24966856 AAGAGTTGTGAGGATGGGCAAGG + Intergenic
1106639410 13:31567636-31567658 AAGAATATTTAGGCTGGGCATGG - Intergenic
1106675931 13:31958013-31958035 AAGGTTCTTTGGGATGGGCACGG + Intergenic
1106733833 13:32569226-32569248 AAGGAAATCCAGGCTGGGCACGG - Intergenic
1106788933 13:33135101-33135123 AAGAGTAATCAGAATGGCCAAGG + Intronic
1106821000 13:33464557-33464579 AAATGTATTGAGGCTGGGCATGG + Intergenic
1106893168 13:34268166-34268188 AGGATTATTCAGGCTGGGCACGG - Intergenic
1107688401 13:42927285-42927307 AAGGGTAGGCAGAATGGGCCAGG - Intronic
1108036430 13:46294806-46294828 AAGTGGATTCTGGCTGGGCACGG + Intergenic
1110441684 13:75533274-75533296 ATGGATATTCAGGCTGGGCACGG + Intronic
1110471435 13:75864287-75864309 AAGCATATTCATGCTGGGCACGG + Intergenic
1111356669 13:87115068-87115090 AAGGCTAATAAGGCTGGGCACGG - Intergenic
1111989997 13:95106964-95106986 AAGAGTATTCAGGCTGGGCGTGG + Intronic
1112228470 13:97564529-97564551 AAGGGTTTTCAGGCTGGACGTGG + Intergenic
1115524716 14:34268259-34268281 TAGGGAATTCAGGCTGGACATGG + Intronic
1117055919 14:51911837-51911859 AAAGGCTATCAGGATGGGCATGG - Intronic
1118672976 14:68150232-68150254 AAAAGTCTTCAGGCTGGGCACGG - Intronic
1118883008 14:69844370-69844392 ATGGGTGTTCAGGATGAGCTTGG - Intergenic
1119496202 14:75081515-75081537 AAAAGTATTCATGATGGTCAGGG - Exonic
1119933153 14:78567144-78567166 AAGGGGCTGCAGGATGGGCCTGG + Intronic
1120288349 14:82534391-82534413 AAGTATAATCAAGATGGGCAAGG - Intergenic
1120978949 14:90274200-90274222 ACGGGGACTCAGCATGGGCAGGG + Exonic
1122396309 14:101434892-101434914 AGGGGTCATCAGGCTGGGCACGG - Intergenic
1123662400 15:22575796-22575818 AAGAGACTCCAGGATGGGCATGG - Intergenic
1124261889 15:28200104-28200126 AAGAGACTCCAGGATGGGCATGG + Intronic
1124316200 15:28670080-28670102 AAGAGACTCCAGGATGGGCATGG - Intergenic
1125499979 15:40233648-40233670 ACGGGTTTTCAGGCTGGGCGTGG - Intergenic
1127116484 15:55732782-55732804 AAGGGTTTACCGGCTGGGCATGG - Intronic
1127343269 15:58067806-58067828 AAAGGTATAGAGGCTGGGCACGG + Intronic
1128018346 15:64367836-64367858 AAGTGTAATGAGGCTGGGCACGG - Intronic
1128150974 15:65363316-65363338 AAGGGCCTTCAGGATGGGGATGG + Intronic
1128480083 15:68029731-68029753 TAGGGCATTCAGGCTGGGCGTGG + Intergenic
1129149820 15:73681590-73681612 TAGGGTATTCAGGAAAGGGAGGG + Intergenic
1130007759 15:80117510-80117532 CTGAGTATTCAGGCTGGGCACGG - Intronic
1130415654 15:83692393-83692415 AAGAGTTTTGAGGCTGGGCACGG + Intronic
1131360272 15:91784486-91784508 ATGGATCTTCAGGCTGGGCACGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132111264 15:99104023-99104045 AAGATTATTTAGGCTGGGCACGG + Intronic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1133945781 16:10347081-10347103 AAGACTATGCAGGCTGGGCACGG + Intronic
1134006802 16:10823304-10823326 AAGGGAACTCAGGCAGGGCATGG + Intergenic
1134667215 16:16027520-16027542 AATGGTATATAGGTTGGGCACGG + Intronic
1135003589 16:18799300-18799322 AAGGATATTTAGGCTGGGCCTGG - Intronic
1135660466 16:24292121-24292143 GAAGGCATTCAGGATGAGCAAGG + Intronic
1135798980 16:25474903-25474925 AAGGGAAATCAGCATGGGTACGG - Intergenic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136103020 16:28009363-28009385 AAGGGCATGCAGGGGGGGCAGGG - Intronic
1136145816 16:28316053-28316075 AATTGTATTTAGGCTGGGCATGG - Intronic
1137627046 16:49915762-49915784 AAGTGTTTTAAGGCTGGGCAGGG + Intergenic
1138811428 16:60154944-60154966 TAAGGTATTTAGGCTGGGCATGG - Intergenic
1139931968 16:70534954-70534976 CAGTGTGTTCAGGCTGGGCATGG - Intronic
1140398397 16:74648793-74648815 GGGGATATTCAGGTTGGGCATGG + Intronic
1140700861 16:77580383-77580405 AAGTGTATTTAGGCCGGGCACGG + Intergenic
1140919167 16:79520846-79520868 AAGGGTATTCACCATGTGCCTGG + Intergenic
1141458624 16:84162528-84162550 AAGGAAATACTGGATGGGCATGG + Intronic
1142667352 17:1470586-1470608 ATGGGTGTTCAGGAGGGGCGGGG - Intronic
1142743593 17:1943837-1943859 TGGGGTGTGCAGGATGGGCAGGG + Intronic
1144318877 17:14093895-14093917 AAGAATATTCTGGCTGGGCATGG + Intronic
1145021634 17:19436132-19436154 AAGGCTCTTCAGGCTAGGCACGG + Intergenic
1145829012 17:27899923-27899945 AAGGCTTTTCTGGCTGGGCAAGG + Intergenic
1145987754 17:29058791-29058813 AACGGAATTCTGGCTGGGCATGG + Intergenic
1148336712 17:46846954-46846976 AAAGGTATTTGGGAGGGGCAGGG - Intronic
1148600134 17:48887989-48888011 AATGGAATGCAGGCTGGGCACGG + Intergenic
1148622409 17:49044279-49044301 CTGGGTTTTCAGGCTGGGCAGGG + Intronic
1148712372 17:49691161-49691183 ATGGGTATTCAGGGTTGTCACGG - Intergenic
1148832769 17:50445502-50445524 AAGTGTCTACAGGCTGGGCATGG + Intronic
1149586406 17:57790574-57790596 ATGGGTGTTCAGGATGGGGAGGG - Intergenic
1149788743 17:59458908-59458930 AATGATATTTAGGCTGGGCATGG + Intergenic
1150028743 17:61708349-61708371 AAGAGTATACAGCATGGACATGG - Intronic
1150575256 17:66425050-66425072 AACAGTATACAGGCTGGGCACGG - Intronic
1151156956 17:72131556-72131578 TACTGTATCCAGGATGGGCAGGG - Intergenic
1151643667 17:75414892-75414914 AAGGCTATTGAGGCCGGGCACGG + Intergenic
1152188090 17:78871064-78871086 CAGGGTGTTCTGGATGGGAACGG - Intronic
1153556649 18:6322064-6322086 AAAGGAAATAAGGATGGGCATGG + Intronic
1153694869 18:7630006-7630028 GAGGGTATTCAGGGTGGAGAGGG + Intronic
1154139744 18:11812551-11812573 AATGACATTCAGGCTGGGCACGG + Intronic
1157530459 18:48416077-48416099 AAGGTTATGCAGGATGGGGGTGG + Intergenic
1158789918 18:60766681-60766703 CAGGGGTTTCAAGATGGGCAGGG - Intergenic
1158965110 18:62615815-62615837 AAGCGTGTTTAGGCTGGGCATGG - Intergenic
1160194712 18:76743017-76743039 AAGTGTATTCAGGGAGGGAAAGG + Intergenic
1160347462 18:78145666-78145688 AATGGAAGTCTGGATGGGCAAGG - Intergenic
1161042834 19:2119118-2119140 GAGGATAAGCAGGATGGGCAGGG + Intronic
1161717326 19:5883731-5883753 AATTTTATTCAGGCTGGGCACGG + Intronic
1161918304 19:7247227-7247249 AAGTGGATTAAGGATGGGGAAGG - Intronic
1162487706 19:10971756-10971778 AAAAGTATTCAGGGTGGGCATGG - Intronic
1162634343 19:11955290-11955312 AAGAATTTTCAGGCTGGGCACGG - Intronic
1163380587 19:16964968-16964990 AAAGGTCTTCGGGCTGGGCACGG + Intronic
1163475600 19:17524220-17524242 GAGGGGATAGAGGATGGGCATGG - Intronic
1163495537 19:17644481-17644503 AATGGAATCCAGGCTGGGCATGG - Intronic
1163589412 19:18183322-18183344 AAGTGAATTGAGGGTGGGCACGG - Intergenic
1163657670 19:18557069-18557091 AAGGGTTTACAGGCTGGGCGCGG - Intergenic
1164511559 19:28901292-28901314 AAGGAGATTCAGGCTGGGCACGG + Intergenic
1164739122 19:30563840-30563862 AGGGGTTGTCAGGCTGGGCAAGG - Intronic
1165563945 19:36706948-36706970 AAAAGTATAAAGGATGGGCAAGG - Intronic
1165589494 19:36955106-36955128 AAAGGTTTACAGGCTGGGCATGG - Intronic
1166322666 19:42028332-42028354 CAGGGTATACAGGATGGGTTGGG - Intronic
1166845687 19:45726793-45726815 AAAGGTACTGAGGCTGGGCAAGG - Intronic
1166855274 19:45780117-45780139 AAGGGTGTGCAGGATGGTTAGGG + Exonic
1166908608 19:46134028-46134050 TAGGGTATGCAGGCTGGGCTGGG + Intergenic
1168396045 19:56049599-56049621 AAAGAAATTCAGGCTGGGCACGG - Intronic
925244741 2:2371277-2371299 ATGGGCATTTAGGTTGGGCATGG + Intergenic
925967465 2:9079264-9079286 AAGGGAATTGAGGCTGGGCAAGG + Intergenic
926094257 2:10070937-10070959 AAGGGTTCTCAGGCTGGGCGTGG - Intronic
926790011 2:16561191-16561213 AAGGGTTTTCAGCATTGGCGTGG + Exonic
927794643 2:26037346-26037368 AAGAGTGTTAAGGCTGGGCACGG + Intronic
928526370 2:32145385-32145407 AATGGTTTTAAGGCTGGGCATGG - Intronic
930799112 2:55424056-55424078 AAGGGTATTCTGGACAGGGATGG - Intergenic
932282301 2:70504121-70504143 AAATGTATACAGGCTGGGCACGG + Intronic
932478858 2:72026501-72026523 AAGAGTATTCAGGCTTGGCCAGG + Intergenic
932833061 2:75009141-75009163 ATGAGAATTCAGGATTGGCATGG + Intergenic
933358748 2:81249939-81249961 AAAGGTATTGAGGCCGGGCACGG + Intergenic
933702932 2:85268730-85268752 AAAGGCATCCAGGCTGGGCACGG - Intronic
934664891 2:96163370-96163392 AGGGGTCTCAAGGATGGGCAGGG - Intergenic
935970149 2:108523219-108523241 AAGGAAATTCTGGCTGGGCAAGG - Intergenic
936174451 2:110207465-110207487 AAGAAAATTCAGGCTGGGCACGG + Intergenic
937503329 2:122507961-122507983 AAGGATATTAAGGCTGGGCACGG + Intergenic
938092191 2:128441213-128441235 AAGGGTAGGCAGGCAGGGCAGGG - Intergenic
939579960 2:143936668-143936690 AAGGGGAGTGGGGATGGGCACGG - Intergenic
939928856 2:148207113-148207135 AAGGATGTGCAGGAGGGGCAAGG + Intronic
940447601 2:153794807-153794829 AAAGTTATCCAGGCTGGGCACGG - Intergenic
940715399 2:157217834-157217856 AAGGATTTTCAGCCTGGGCATGG + Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941950670 2:171152618-171152640 AATAGTATTCAGTATGGGCAAGG - Intronic
942021255 2:171868133-171868155 AAATGTATTCAGGCTGGGCGCGG - Intronic
943626525 2:190207588-190207610 AAGTATATCCAGGCTGGGCACGG + Intronic
943887179 2:193234258-193234280 AAGGCAATTCAGGCCGGGCACGG + Intergenic
945304995 2:208251372-208251394 AAGGATAATCTGGCTGGGCATGG - Intronic
945749352 2:213761569-213761591 AGGGACATTCAGGCTGGGCACGG + Intronic
947587096 2:231363070-231363092 CAAGGTATTCAGGAAGTGCAGGG + Intronic
947644706 2:231729937-231729959 AAGGTAATTCAGGCTGGGCGCGG + Intergenic
947790742 2:232867086-232867108 AAGGGTGTTCAGGCTTGGCTGGG - Intronic
948057957 2:235023254-235023276 ATGGGAATTCAGGCTGGGCACGG + Intronic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
1169586590 20:7092570-7092592 AAGGGTTTTCAGGCTGAGGAAGG - Intergenic
1170654357 20:18272232-18272254 AAATGAATTCAGGCTGGGCATGG - Intergenic
1170712696 20:18806692-18806714 GAGCATGTTCAGGATGGGCAGGG + Intergenic
1171463479 20:25311996-25312018 AAGTGTATTCTGGCTGGGCACGG - Intronic
1173701063 20:45072051-45072073 GAAGGTATTCACGCTGGGCATGG - Intronic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1176031123 20:63012568-63012590 AAGGAAAAACAGGATGGGCATGG - Intergenic
1176380254 21:6109037-6109059 AAGGGAAAACAGGATGGCCATGG + Intergenic
1176734254 21:10528894-10528916 AAGTGTTTTCTGGCTGGGCATGG + Intronic
1176739824 21:10591060-10591082 AAGAGTTGTGAGGATGGGCAAGG - Intronic
1177321011 21:19520925-19520947 AAGGGTAGTGAAGATGGCCAGGG - Intergenic
1177415856 21:20792800-20792822 AAAGGAATTCTGGCTGGGCACGG + Intergenic
1178897467 21:36571128-36571150 AAGGAGATGCAGGCTGGGCACGG - Intronic
1179207769 21:39299682-39299704 AAAGGGACTCAGGCTGGGCACGG + Intronic
1179743220 21:43429201-43429223 AAGGGAAAACAGGATGGCCATGG - Intergenic
1180561991 22:16624376-16624398 AAGTGTTTTCTGGCTGGGCATGG + Intergenic
1180595367 22:16969644-16969666 AAGGGTATTCCGCCTGGGGATGG + Intronic
1181581067 22:23828366-23828388 AAGGGTTTTCAGGCTAGGCATGG + Intronic
1181588041 22:23864815-23864837 AAAGTTATTCAGGCTGGGCGTGG + Intronic
1182306416 22:29372130-29372152 AAGGGAACTGAGGCTGGGCATGG + Intronic
1182505520 22:30779602-30779624 AAGTGTATCCAGGAAGGGAAGGG - Intronic
1183256961 22:36768702-36768724 AAGGGAATTAAAGATGGGCAGGG - Intronic
1184001663 22:41678962-41678984 GAGAGTATTCTGGCTGGGCATGG + Intronic
1184921663 22:47609711-47609733 AAGGTGATTTCGGATGGGCAAGG + Intergenic
949098963 3:120199-120221 AAGGTTATTAAAGATGGGGAGGG + Intergenic
949166159 3:943887-943909 AAAGGAATGCAGGCTGGGCACGG + Intergenic
949708759 3:6849962-6849984 AAGAGTCTTGAGGATGGGCCAGG + Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
950677610 3:14564125-14564147 AAGCGTTTTCAGTATGGGCTAGG + Intergenic
951585601 3:24211971-24211993 AAGGAAATTGAGGCTGGGCACGG + Intronic
953374027 3:42413571-42413593 AATGCTATGGAGGATGGGCAAGG + Intergenic
954586080 3:51737934-51737956 GAGGGCATTCAGGCTGGGGATGG - Intergenic
954697503 3:52435567-52435589 AGGGGTGGTCAGGATGGGCTGGG - Exonic
954855573 3:53641128-53641150 AAGGGGCATCAGGAGGGGCAGGG + Intronic
955338339 3:58105299-58105321 AAAGGTATTGAGGCTAGGCAAGG - Intronic
956111128 3:65870790-65870812 AAAGATATTCAGGCCGGGCATGG + Intronic
956432902 3:69205497-69205519 AAAGGGACTCAGGCTGGGCATGG - Intronic
958007610 3:87832616-87832638 AGGGGTATTCTGGCTGGGCGCGG - Intergenic
959479600 3:106855026-106855048 AAGAATATTGAGGCTGGGCATGG - Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
960570684 3:119182392-119182414 GAGGATATTTAGGAAGGGCAGGG - Intronic
960932458 3:122867689-122867711 AAATGTATTCAGGCTAGGCACGG + Intronic
961857206 3:129884335-129884357 AAGAATTTTCAGGCTGGGCATGG + Intronic
962547411 3:136451471-136451493 AAAGGTATGCAGGCTGGGCATGG + Intronic
965328389 3:167337225-167337247 AAGCTTATTTAGGCTGGGCAGGG + Intronic
966133472 3:176671481-176671503 AAGAGTAATCAGGCTGGGCGTGG + Intergenic
966604988 3:181812809-181812831 AATGGTAAACAGGCTGGGCATGG - Intergenic
967022717 3:185536546-185536568 CAGGTTATTAAAGATGGGCAAGG - Intronic
967052127 3:185794558-185794580 AAGGGAACTCTGGATGTGCATGG - Intronic
967153445 3:186670835-186670857 AAGGGTATGGAGGCTGGGCGTGG - Intronic
968061712 3:195730901-195730923 CAGGGTTTTGAGGATGGGGATGG + Intronic
968318504 3:197744993-197745015 AGGGGGATTTAGGCTGGGCACGG + Intronic
970948911 4:21729147-21729169 AATTGTATTCAGTATGGGTAGGG - Intronic
971258617 4:25035659-25035681 AAGGCCAGTCAGGATGGGAAGGG + Intergenic
971323310 4:25622941-25622963 AAGGTCATTCAGGCTAGGCACGG + Intergenic
971494138 4:27246324-27246346 AAGGATCTTAAGGCTGGGCATGG + Intergenic
972788889 4:42351743-42351765 AAAGCTTTTCAGGCTGGGCACGG + Intergenic
973004366 4:44990138-44990160 ATGGGTTTTCAAGATGGGCTTGG - Intergenic
973210696 4:47612273-47612295 AATGGCCCTCAGGATGGGCAGGG - Intronic
974166428 4:58210737-58210759 AAGCCTATTCAGGACGGACATGG - Intergenic
975229012 4:71908688-71908710 TAGGGTATGCAGGTTGGGCTGGG + Intergenic
976120869 4:81780099-81780121 AAGACTTTTCAGGCTGGGCATGG + Intronic
976613888 4:87056760-87056782 AAGTGTAATCAGTATGAGCAAGG + Intronic
977170975 4:93762528-93762550 AAGGATATTCAGGAGAGGAAAGG + Intronic
978954255 4:114595632-114595654 AAGGGGTTGCAGGATGGTCACGG - Intergenic
979958125 4:126981131-126981153 AAGAATATCCAGGCTGGGCATGG + Intergenic
980115617 4:128676213-128676235 AATAGCATTTAGGATGGGCATGG - Intergenic
980268269 4:130548639-130548661 AAGGTTATTCTGGGTGGGCCTGG - Intergenic
981308294 4:143269398-143269420 AAGAAGATTCAGGATGGGCTCGG - Intergenic
982413406 4:155104625-155104647 AAGGAGATTGAGGCTGGGCATGG - Intergenic
982473726 4:155825255-155825277 AAGTGTATTTAGTCTGGGCAGGG - Intergenic
983819556 4:172176047-172176069 GAGTGTATTCAGGCTGGGCGCGG + Intronic
984862151 4:184250928-184250950 AACAGTATCCAGGCTGGGCACGG - Intergenic
984953826 4:185025900-185025922 AAGCTTATCCAGGCTGGGCACGG - Intergenic
985652222 5:1112409-1112431 AAGGGCGTGCAGGAGGGGCAGGG - Intergenic
988412731 5:30908179-30908201 AAGGGTAAGAAGGATGGGAATGG - Intergenic
989023122 5:37033856-37033878 AAATATATTCAGGCTGGGCATGG - Intronic
989619812 5:43373089-43373111 AAGAATGTTCAGGCTGGGCATGG - Intergenic
990197812 5:53338151-53338173 AAGGGGGTTCAGAATGGTCAAGG + Intergenic
990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG + Intronic
993198951 5:84787914-84787936 ATGGGTTTCCAGGCTGGGCATGG + Intergenic
993395557 5:87382791-87382813 AAAGTTTTTCAGGCTGGGCATGG + Intronic
993760443 5:91789574-91789596 TAAAGTATTCAGGCTGGGCAGGG + Intergenic
993990334 5:94648768-94648790 GAGGCTGTTCAGGCTGGGCACGG - Intronic
994108182 5:95969575-95969597 TAGGGTATTAATGATGGGAATGG + Intergenic
994765775 5:103915560-103915582 AAGGGATTCCAGGGTGGGCAGGG - Intergenic
995087594 5:108132264-108132286 AAGGACTTTCAGGCTGGGCACGG - Intronic
996109989 5:119554077-119554099 AAGGGTATTCAGGATGGGCACGG - Intronic
997519661 5:134514665-134514687 AAGCATATGCAGGATGGTCAAGG - Intergenic
998305102 5:141068328-141068350 AAGGGAATTAAGGTTGTGCATGG - Intergenic
999073538 5:148773132-148773154 AAGGGTATGGACGATGGGGAAGG - Intergenic
999397085 5:151236513-151236535 AATTGTATTCAGGCTGGGCACGG + Intronic
999661438 5:153867343-153867365 AAGGGCATTATTGATGGGCAAGG - Intergenic
1000186669 5:158865180-158865202 AAGGGTGAACAGGATGGGAAGGG - Intronic
1000826475 5:166051336-166051358 AAGGGGATTCAGGCGTGGCACGG + Intergenic
1002088945 5:176793255-176793277 AAGGGGATTCAGTCTGGGCCAGG - Intergenic
1002152133 5:177242817-177242839 AAGGCCATTCTGGCTGGGCACGG - Intronic
1002997149 6:2297518-2297540 TAGGGTATACAGGCTGGGCTGGG + Intergenic
1003070859 6:2944790-2944812 AAGGGAATTAAGTATGGGAAGGG - Intergenic
1003070875 6:2944862-2944884 AAGGGAATTAAGTATGGGAAGGG - Intergenic
1003858612 6:10300868-10300890 AAGGGTTGTGAGGCTGGGCACGG - Intergenic
1004617306 6:17303034-17303056 AATGCTATTCAGGCCGGGCACGG + Intergenic
1004868715 6:19881030-19881052 AAGGGTTTGCAGGATAGGCAAGG + Intergenic
1005373036 6:25154769-25154791 TAGGGTATGCAGGATGGGCTGGG - Intergenic
1006277393 6:33016141-33016163 ATTGGTGTTCAGGATGGTCATGG - Intergenic
1007712197 6:43831515-43831537 TGGGGCATTCAAGATGGGCAGGG - Intergenic
1007988835 6:46234017-46234039 AAGTGTCTTCAGGCCGGGCACGG - Intronic
1008799565 6:55349709-55349731 AAGGGTTTTTATGCTGGGCAGGG + Intronic
1011595561 6:89012949-89012971 AAGGCTATACAGGCTGGGCGTGG + Intergenic
1012532541 6:100255457-100255479 AATGGTATTTAGGAAGGCCAAGG + Intergenic
1014354417 6:120387026-120387048 AAGAGTATTCAGGCTGGGCATGG - Intergenic
1016039310 6:139415438-139415460 AAGTTTATCCAGGCTGGGCACGG - Intergenic
1016064181 6:139662025-139662047 CAATGTATTCAGGCTGGGCACGG - Intergenic
1016774733 6:147892915-147892937 AAAAGTATTCAGTATGGGCCAGG + Intergenic
1016813593 6:148283479-148283501 AAGAGTATTCCGGCTGGGCGCGG + Intronic
1017454404 6:154587535-154587557 AAGGGGATACAGGCTGGGCACGG + Intergenic
1018711340 6:166500000-166500022 AAGGGTCTTCAGGTTAGGAAGGG + Intronic
1018992367 6:168683955-168683977 AAAGGGATTAAGGATGGGAAGGG + Intergenic
1019694056 7:2434795-2434817 ATGGCTATTAAGGCTGGGCACGG + Intergenic
1019813724 7:3184135-3184157 AGGGGTATTTTGGCTGGGCATGG - Intergenic
1021817905 7:24466170-24466192 AAGGGCATGCAAGACGGGCAAGG + Intergenic
1022342927 7:29485906-29485928 AAGGGTATCCTGGAAGTGCATGG - Intronic
1024492224 7:49998204-49998226 AAGGGCATTTAGGCTGGGCGTGG - Intronic
1024902502 7:54336469-54336491 AAGGGTATTTAGGATGAGACTGG - Intergenic
1024959747 7:54961597-54961619 AAGTGTAAGCAGGCTGGGCATGG + Intergenic
1025100387 7:56129815-56129837 AAGCGTCTTCTGGACGGGCATGG - Intergenic
1025138153 7:56438058-56438080 AAGTTTATTCAGGCTGGGCGCGG + Intergenic
1025240372 7:57266835-57266857 AAGGGTGGCCAGGCTGGGCACGG - Intergenic
1025732753 7:64121011-64121033 AAAAGTCTTCAGGCTGGGCATGG + Intronic
1026242700 7:68591028-68591050 AAGGGAATTCCAGCTGGGCATGG + Intergenic
1026303484 7:69119711-69119733 AAGTACATTTAGGATGGGCATGG - Intergenic
1026491439 7:70867419-70867441 AAGGGTAGTCCGGAGGGGAATGG - Intergenic
1026744587 7:73001166-73001188 AAGTTCATTCAGGCTGGGCATGG + Intergenic
1027030695 7:74885831-74885853 AAGTTCATTCAGGCTGGGCATGG + Intergenic
1027099150 7:75363926-75363948 AAGTTCATTCAGGCTGGGCATGG - Intergenic
1027110501 7:75434863-75434885 AATAGTATCTAGGATGGGCATGG - Intronic
1027209968 7:76138228-76138250 AAGGGTCATCAGGATGATCATGG - Intergenic
1029378396 7:100196458-100196480 AAGTTCATTCAGGCTGGGCATGG - Intronic
1029400250 7:100340706-100340728 AAGTTCATTCAGGCTGGGCATGG - Intronic
1029411130 7:100411557-100411579 AAGGTAATTGAGGCTGGGCATGG - Intronic
1029414561 7:100434860-100434882 AGGTGTAAACAGGATGGGCAAGG + Intergenic
1029724547 7:102393756-102393778 TAGGGTATGCAGGCTGGGCTGGG - Intronic
1030069687 7:105688188-105688210 TAGGGTATGCAGGCTGGGCTGGG - Intronic
1030871301 7:114759469-114759491 AAGGCAATTAAGGAAGGGCATGG - Intergenic
1033230537 7:139594014-139594036 AAGGGGCTTCAGGATGGAAAGGG - Intronic
1034926656 7:155128210-155128232 AAGGGTTTTAGGGTTGGGCACGG - Intergenic
1035186984 7:157134075-157134097 AAAGATTTTCAGGCTGGGCATGG - Intergenic
1036017991 8:4807485-4807507 TAGGTGATTCAGGATGGGCTGGG - Intronic
1036393620 8:8347635-8347657 AAAGGTATTCAGGATAGACAAGG - Intronic
1037491116 8:19397909-19397931 AAGTGTTTTCTGGCTGGGCACGG + Intergenic
1038580223 8:28741746-28741768 AAGGTGATCCAGGCTGGGCATGG - Intronic
1039216934 8:35282402-35282424 AAGGGTATTAAGAAGGGTCATGG - Intronic
1039524329 8:38200295-38200317 AAGGGTACCCAGGCTGGGCACGG - Intronic
1039930200 8:41979708-41979730 AAGTGAATTCAGGCTGGGCGCGG + Intronic
1041098831 8:54376259-54376281 AACAGAATTCAGGCTGGGCACGG - Intergenic
1041251958 8:55943308-55943330 AAGAATTTTCAGGCTGGGCATGG + Intronic
1041292892 8:56323691-56323713 AAAAGAATTCAGGATTGGCAAGG + Intergenic
1042230523 8:66549778-66549800 AAGGAGATCCTGGATGGGCATGG + Intergenic
1042552721 8:70008508-70008530 AAGGATTTTAAGGAGGGGCAGGG + Intergenic
1042843557 8:73148363-73148385 GAGGTTTCTCAGGATGGGCAGGG + Intergenic
1043009526 8:74864546-74864568 AAGTATTTTCAGGATGGGCGCGG + Intergenic
1043430610 8:80190936-80190958 ATGGTTATTCAGTCTGGGCACGG + Intronic
1043448457 8:80342146-80342168 AAGGACCTTCAGGCTGGGCAAGG - Intergenic
1043456255 8:80415319-80415341 AAATGCATTCAAGATGGGCATGG - Intergenic
1044644904 8:94430021-94430043 AATAGTATTTAGGCTGGGCACGG + Intronic
1046246687 8:111572781-111572803 AAGTATATGCAGGCTGGGCATGG - Intergenic
1047713363 8:127573779-127573801 AAGGGTTTCCAGGATGGACTGGG - Intergenic
1048011143 8:130457168-130457190 AAGCATCTTCAGGATGGGCGCGG - Intergenic
1048141616 8:131800532-131800554 GAGGGTATGCAGGATGGTAAGGG + Intergenic
1048735115 8:137490553-137490575 TAGGGAATTCAAGATGGACAGGG + Intergenic
1049954735 9:681987-682009 AATGTTATTTAGGCTGGGCACGG + Intronic
1050118214 9:2282071-2282093 AATTGTCTTCAGGATGGGGATGG - Intergenic
1052229013 9:26124574-26124596 AAGAGTATTCAGGCCAGGCATGG + Intergenic
1052536685 9:29756417-29756439 GAGGGCATTCAGGCTGGGCATGG - Intergenic
1052990114 9:34514180-34514202 CTGGGGGTTCAGGATGGGCAGGG - Intronic
1053199608 9:36143480-36143502 AAGGGACTTTAGGATGGGCCTGG + Intronic
1053834983 9:42125906-42125928 AATGGAGTTCAGGCTGGGCACGG - Intronic
1054595549 9:67061623-67061645 AATGGAGTTCAGGCTGGGCACGG + Intergenic
1055279130 9:74654282-74654304 AAGAGTATTGAGGATGGGGTAGG + Intronic
1055811655 9:80155727-80155749 AAGGGTAGTCAGCATGGGAGTGG + Intergenic
1057163753 9:92910163-92910185 AAGTATATTCAGGCTGGGCGCGG - Intergenic
1057382351 9:94580505-94580527 AAGGCAATCCAGGCTGGGCATGG - Intronic
1057630246 9:96714223-96714245 ACTGGGATTCAGGCTGGGCACGG + Intergenic
1060946550 9:127572752-127572774 AATGATATTCAGGCTGAGCACGG + Intronic
1060983025 9:127804289-127804311 CAGGGTATTGAGCATGCGCACGG - Exonic
1061187503 9:129063355-129063377 AGGGGTAGTCAGGCTGGCCATGG + Intronic
1061979982 9:134096819-134096841 AAGGAGATTCTGGCTGGGCACGG + Intergenic
1186297244 X:8163369-8163391 ATGTCTATTCAGGCTGGGCACGG - Intergenic
1186606463 X:11097963-11097985 AAGGGTTACCAGGATGAGCAAGG + Intergenic
1186786149 X:12957460-12957482 AAGAGTATTCTGGCTGGGCGCGG + Intergenic
1187363392 X:18648044-18648066 AACGGTGTTGAGGCTGGGCACGG + Intronic
1187437581 X:19286863-19286885 CAGCCTATTCAGGCTGGGCATGG + Intergenic
1193369121 X:80672316-80672338 AAGGGTATATAGGCCGGGCACGG + Exonic
1195584109 X:106543860-106543882 AAGAGTATTGAGGCTGGGCATGG - Intergenic
1195590554 X:106620380-106620402 AAAGCTCTTCAGGATGGGCACGG + Intronic
1195966373 X:110433462-110433484 AAGGGTAATGAGGAAGGGCAGGG + Intronic
1196030381 X:111090215-111090237 AAGGGGCTTCATTATGGGCATGG - Intronic
1198337396 X:135679834-135679856 ATGGGTTTTCAGGAGGGACATGG + Intergenic
1198361795 X:135902980-135903002 ATGGGTTTTCAGGAGGGACATGG - Intronic
1198774835 X:140168571-140168593 AAACGTTTTCAGGCTGGGCATGG - Intergenic
1198965182 X:142220968-142220990 AAGAGTATTAAGGAAGGGGAAGG + Intergenic
1199943470 X:152647438-152647460 TAGGGATTTCAGGGTGGGCAAGG - Intronic
1200796708 Y:7347710-7347732 AAGACCATTCAGGTTGGGCATGG + Intergenic
1202592281 Y:26498418-26498440 AAGTGTTTTCTGGCTGGGCATGG + Intergenic