ID: 996113454

View in Genome Browser
Species Human (GRCh38)
Location 5:119592340-119592362
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996113453_996113454 -8 Left 996113453 5:119592325-119592347 CCAATCAGAGTAGCTGTTCTGCA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG No data
996113452_996113454 5 Left 996113452 5:119592312-119592334 CCAAAGGAGATTTCCAATCAGAG 0: 1
1: 0
2: 5
3: 54
4: 324
Right 996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr