ID: 996113457 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:119592356-119592378 |
| Sequence | CTGTAGGAGGCACCTTCCAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 169 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 26, 4: 141} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996113453_996113457 | 8 | Left | 996113453 | 5:119592325-119592347 | CCAATCAGAGTAGCTGTTCTGCA | 0: 1 1: 0 2: 0 3: 9 4: 106 |
||
| Right | 996113457 | 5:119592356-119592378 | CTGTAGGAGGCACCTTCCATAGG | 0: 1 1: 0 2: 1 3: 26 4: 141 |
||||
| 996113452_996113457 | 21 | Left | 996113452 | 5:119592312-119592334 | CCAAAGGAGATTTCCAATCAGAG | No data | ||
| Right | 996113457 | 5:119592356-119592378 | CTGTAGGAGGCACCTTCCATAGG | 0: 1 1: 0 2: 1 3: 26 4: 141 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996113457 | Original CRISPR | CTGTAGGAGGCACCTTCCAT AGG | Intronic | ||