ID: 996113458 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:119592364-119592386 |
| Sequence | GGCACCTTCCATAGGTCTTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996113453_996113458 | 16 | Left | 996113453 | 5:119592325-119592347 | CCAATCAGAGTAGCTGTTCTGCA | 0: 1 1: 0 2: 0 3: 9 4: 106 |
||
| Right | 996113458 | 5:119592364-119592386 | GGCACCTTCCATAGGTCTTCTGG | No data | ||||
| 996113456_996113458 | -10 | Left | 996113456 | 5:119592351-119592373 | CCATGCTGTAGGAGGCACCTTCC | 0: 1 1: 0 2: 3 3: 22 4: 213 |
||
| Right | 996113458 | 5:119592364-119592386 | GGCACCTTCCATAGGTCTTCTGG | No data | ||||
| 996113452_996113458 | 29 | Left | 996113452 | 5:119592312-119592334 | CCAAAGGAGATTTCCAATCAGAG | No data | ||
| Right | 996113458 | 5:119592364-119592386 | GGCACCTTCCATAGGTCTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996113458 | Original CRISPR | GGCACCTTCCATAGGTCTTC TGG | Intronic | ||