ID: 996113697

View in Genome Browser
Species Human (GRCh38)
Location 5:119595200-119595222
Sequence TATTCAGTTGCCACTCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996113695_996113697 15 Left 996113695 5:119595162-119595184 CCATAAGATGGGCTATTTGAACA 0: 1
1: 1
2: 1
3: 14
4: 169
Right 996113697 5:119595200-119595222 TATTCAGTTGCCACTCTCAGTGG No data
996113694_996113697 19 Left 996113694 5:119595158-119595180 CCTACCATAAGATGGGCTATTTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 996113697 5:119595200-119595222 TATTCAGTTGCCACTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996113697 Original CRISPR TATTCAGTTGCCACTCTCAG TGG Intronic
No off target data available for this crispr